Labshake search
Citations for Lonza :
1601 - 1650 of 1724 citations for 6 IODO 2 PIPERAZIN 1 YL QUINOLINE since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Systems Biology 2020Quote: ... 24 hours activated DC and T cells were incubated in 96 well plates at a DC/T ratio 1:5 in Xvivo15 medium (Lonza). After 6 days ...
-
bioRxiv - Microbiology 2020Quote: ... The same number of cells (2 x 106 cells) were lysed in 100 µl of 1% CHAPS/PBS and analyzed on 4-20% SDS-PAGE gel (Lonza). The envelope proteins were detected by 2F5 (specific for gp41 ...
-
bioRxiv - Immunology 2021Quote: ... MICB or ULBP-1 genes after optimizing nucleofection conditions using primary cell 4D nucleofector kit and 4D nucleofector system (Lonza). After 48 hours of culture ...
-
bioRxiv - Neuroscience 2022Quote: ... and ssODN (1 μl,stock 100 μM) in 20 μl of nucleofection buffer P3 were nucleofected (program CA137, 4D-Nucleofector Device, Lonza) into 500,000 detached iPSCs (Deneault et al. ...
-
bioRxiv - Microbiology 2022Quote: ... Ribonucleoproteins were introduced into 1 × 106 sub-confluent BlaER1 cells using 4D-Nucleofector X Unit and SF Cell line Kit (Lonza), applying program DN-100 ...
-
bioRxiv - Immunology 2022Quote: ... COPD or smoker human donors (Table 1) were grown using Bronchial Epithelial Growth Media (CC-3170) and harvested using ReagentPack Subculture reagents (CC-5034) (Lonza). BEAS-2B bronchial epithelial cells were obtained from the American Type Culture Collection (ATCC CRL-9609 ...
-
bioRxiv - Microbiology 2022Quote: ... 10 μg of the pSAG1::Cas9-U6::sgUPRT vector15 and 10 μg of the barcode oligo (equivalent to an ~1:160 molar ratio of plasmid to oligo) were co-transfected into approximately 1×106 extracellular tachyzoites using the 4D-Nucleofector X Unit programme F1-115 (Lonza). 24 hours post-transfection ...
-
bioRxiv - Cancer Biology 2022Quote: ... and TILs were resuspended at a cell density of 1 million cells in 20 µL P3 electroporation buffer with supplement (Lonza) and then combined with 3 µL of RNP mixture and nucleofected using program DJ-110 (melanoma ...
-
bioRxiv - Immunology 2020Quote: ... Rinsed cells were resuspended in buffer P4 (mouse) or P2 (human) at 1-10 x 106 cells/20 μL (Lonza). Non-targeting Alt-R crRNA #1 ...
-
bioRxiv - Neuroscience 2021Quote: ... dissociated with Accutase and then transfected with one of the Tau or Tubulin pUCM vectors along with AAVS1 TALEN pairs using a Human Stem Cell Nucleofector Kit 1 (Lonza) with the Nucleofector 2b Device (Lonza) ...
-
bioRxiv - Immunology 2021Quote: CD4+ T cells were activated with plate-bound α-CD3 (3.75 µg/ml; Immunotech) and soluble α-CD28 (1 μg/mL; Immunotech) in X-vivo 20 serum-free medium (Lonza). X-vivo 20 medium was supplemented with L-glutamine (2 mM ...
-
bioRxiv - Microbiology 2021Quote: ... Cells were washed once in PBS and then resuspended in 1 ml of ACK Red Blood Cell lysis buffer (Lonza). After washing with PBS ...
-
bioRxiv - Bioengineering 2020Quote: ... 8 volumes of collagen I gel solution (10mg/ml) were mixed with 1 volume of 10X EMEM (Lonza: 12-684F) and 1 volume of 10X Reconstruction buffer(Anacker and Moody 2012 ...
-
bioRxiv - Immunology 2022Quote: ... 1*106 purified naïve T-cells were resuspended in 15 μL buffer P3 + 5 μL Supplement 1 (P3 Primary Cell 4D-NucleofectorTM X Kit S; Lonza) and mixed with 2.7 μL RNP in the 16-well strips provided in the kit ...
-
bioRxiv - Microbiology 2019Quote: ... The cells were washed once in PBS and then resuspended in 1 ml of ACK Red Blood Cell lysis buffer (Lonza). After two rounds of washing with PBS ...
-
bioRxiv - Developmental Biology 2020Quote: ... The guide RNA vector was then electroporated into the parent line containing the CRISPRi system using the Human Stem Cell Nucleofector Kit 1 solution with the Amaxa nucleofector 2b device (Lonza). Nucleofected cells were then seeded into a 6-well plate in mTeSR™-1 supplemented with Y-27632 (10 μM ...
-
bioRxiv - Immunology 2020Quote: 2×106 freshly isolated primary B cells were washed in PBS and resuspended in 20 μl P3 Primary Cell Nucleofector Solution buffer prepared with Supplement 1 buffer (Lonza) according to the manufacturer’s instructions (P3 Primary Cell 4D-Nucleofector X Kit S) ...
-
bioRxiv - Cancer Biology 2021Quote: ... Lung cancer cell lines (H3122, H2228, A549, H460, Calu-1, and H1437) were cultured in RPMI-1640 (Lonza, 15-1675) supplemented with 10% FBS ...
-
bioRxiv - Molecular Biology 2021Quote: ... two pieces of polyethylene tubing (Portex) were connected to two 1 mL gas-tight syringes (SGE) and filled with sterile PBS (Lonza) buffer ...
-
bioRxiv - Molecular Biology 2021Quote: ... The lysis mix and bead suspensions were loaded in the tubing of two individual 1 ml SGE glass syringes filled with PBS (Lonza), and separated by an air bubble from the reagents in the tubing as previously described ...
-
bioRxiv - Bioengineering 2019Quote: Bioharmonophores were immobilized in low melting agarose by mixing 200 μL bioharmonophore with 100 μL 1% SeaPlaque low melting agarose (Lonza) solution in 8-well imaging chambers (Lab-Tek) ...
-
bioRxiv - Molecular Biology 2021Quote: 3T3-L1 fibroblasts were maintained in DMEM supplemented with 10% newborn calf serum (NCS) and 1% penicillin/streptomycin (P/S) (all Lonza). Experiments were performed in six-well plates ...
-
bioRxiv - Cell Biology 2020Quote: ... The purity of CyaA batches is higher than 90% as judged by SDS PAGE analysis and contained less than 1 EU of LPS/μg of protein as determined by a standard LAL assay (Lonza). Finally ...
-
bioRxiv - Immunology 2021Quote: ... Naïve T cells expressing Cas9 were washed once with 1 mL pre-warmed recovery medium (Mouse T Cell Nucleofector Medium, Lonza) before electroporation ...
-
bioRxiv - Immunology 2021Quote: ... CD4+ T-cells were stimulated with plate-bound α-CD3 (3.75 μg/ml; Immunotech) and soluble α-CD28 (1 μg/mL; Immunotech) in X-vivo 20 serum-free medium (Lonza). X-vivo 20 medium was supplemented with L-glutamine (2 mM ...
-
bioRxiv - Immunology 2021Quote: ... The enriched CD4+CD25hi cells were cultured in 24-well non-tissue culture plates at 1 x 106 cells/mL in X-Vivo-15 (Lonza) supplemented with 10% heat-inactivated human AB serum (Sigma) ...
-
bioRxiv - Immunology 2021Quote: ... 1 × 106 NALM6 target cells were transfected with 1 μg plasmid using the Nucleofector 4D (SF cell line Kit, program CV-104, Lonza) following the manufacturer’s instruction ...
-
bioRxiv - Microbiology 2021Quote: African green monkey kidney epithelial BSC-1 cells (ATCC CCL-26) were maintained in Eagle’s minimal essential medium (EMEM; Lonza, Inc.) containing 5% fetal bovine serum (FBS ...
-
bioRxiv - Neuroscience 2022Quote: ... This plasmid was nucleofected into the NGN2 iPS line (obtained as described above) using a nucleofection kit (Human Stem Cell Nucleofector Kit 1, VPH-5012, Lonza) containing 4 μg of RFP PB construct and 1 μg of dual helper plasmid ...
-
bioRxiv - Developmental Biology 2022Quote: ... the cells were nucleofected with 1 nmol ASO against MERVL or Scramble ASO using P3 Primary Cell 96-well Nucleofector Kit (Lonza) according to manufacturer’s instruction and seeded into each well of a 24-well plate containing 500 µl of ESC medium with 2i ...
-
bioRxiv - Cancer Biology 2022Quote: ... Cells were plated at 1 × 104/well in black 96-well plates using Bio Whittaker HBSS (BE10-527F, Lonza, Switzerland) with 4.5 g/L glucose ...
-
bioRxiv - Cancer Biology 2022Quote: ... and resuspended in a mixture of 16.4 µl SF cell line solution and 3.6 µl supplemental solution-1 (Lonza, V4XC-2032). The sgRNA and Cas9 ribonuclease protein complex under incubation was then mixed with the cell suspension and 20 µl of it was put a cuvette and nucleofected using 4D-Nucleofector (Lonza ...
-
bioRxiv - Biochemistry 2022Quote: ... Baculoviral P3 stock was used to infect Sf9 insect cells at 1.5 × 106 cells·mL-1 in Insect-XPRESS media (Lonza #12-730Q) supplemented with 2% FBS (Capricorn #FBS-12A) ...
-
bioRxiv - Cell Biology 2022Quote: ... and a gene-edited iPSC homozygous MYBPC3 knock-out (MYBPC3 (-/-)) (Supplemental Table 1).(15–17) iPSCs were verified to be free of mycoplasma contamination using MycoAlert Detection Kit (Lonza). Newly generated lines were karyotyped (WiCell Institute ...
-
bioRxiv - Synthetic Biology 2022Quote: ... T cells were resuspended in P3 buffer (0.75-1 x 106 cells per 18 μl P3) from the P3 Primary Cell 4D-Nucleofector X Kit S (Lonza). 10 μg/μl Alt-R S.p ...
-
bioRxiv - Microbiology 2022Quote: ... Cells were washed once in PBS and then resuspended in 1 ml of ACK Red Blood Cell lysis buffer (Lonza). After washing with PBS ...
-
bioRxiv - Cell Biology 2022Quote: ... Two million of MNCs were transfected with 10 μg of plasmid (5:1 ratio pEB-C5:pEBTg) as instructed by the Lonza CD34+ nucleofector kit (VPA-1003, Lonza) and Amaxa nucleofector (program T-016 ...
-
bioRxiv - Neuroscience 2023Quote: Larvae were anesthetized with 0.02% ethyl 3-aminobenzoate methanesulfonate salt (Tricane, (E10521, Ethyl 3-aminobenzoate methanesulfonate) and mounted in 1% low melting point agarose (50100, Lonza) in a 60 mm x 15 mm petri dish ...
-
bioRxiv - Cancer Biology 2023Quote: Cell and organoid lines were generated from C3-TAg tumors (supplementary file 1) and tested for mycoplasma (Lonza, LT07-703) prior to use and the creation of frozen stocks ...
-
bioRxiv - Microbiology 2023Quote: ... Knock-down procedures were performed with siRNA purchased from Riboxx (non-targeting siRNA: UUGUACUACACAAAAGUACCCCC; US10 targeting #1: UUCUGAAUAACACAGCCGCCCCC) applying the SE Cell Line Kit (Lonza) for fibroblasts and Lipofectamine RNAiMax (Invitrogen ...
-
bioRxiv - Microbiology 2023Quote: ... Ribonucleoproteins were introduced into 1 x 106 sub-confluent BLaER1 cells using 4D-Nucleofector X Unit and SF Cell line Kit (Lonza), applying program DN-100 ...
-
bioRxiv - Physiology 2023Quote: ... 2 μl of KCNQ2/3 cDNA plasmid (0.9 g/l) and 1 μl of pmax green fluorescent protein vector (0.5 g/l) (Lonza, Cologne, Germany) were diluted in 125 μl of Opti-MEM medium (Life Technologies) ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... Measured tissues originated from six F508del homozygous patients (CF patient #1: CF-AB0609, female, 31 years-old; CF patient# 3: #28388-0000450918, Lonza, male ...
-
bioRxiv - Synthetic Biology 2023Quote: ... and 100 μL of YEA medium containing 1% (w/v) microwave-heated low-melting point agarose (SeaPlaque agarose, 50101; Lonza) was gently added to the central area ...
-
bioRxiv - Cell Biology 2023Quote: ... were delivered as a ribonucleoprotein complex with the DNA donor template using a Nucleofector 2b Device and the Human Stem Cell Nucleofector Kit 1 (Lonza) following manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2023Quote: ... and the ssODN (1 μl; stock 100 μM, IDT) in 20 μl of nucleofection buffer P3 (P3 Primary Cell NucleofectorTM Solution, Lonza) were nucleofected (program CA137 ...
-
bioRxiv - Neuroscience 2023Quote: ... reprogramming was initiated by nucleofection of 1×105 fibroblast with 1 µg of each episomal plasmid (pCXLE-hUL, pCXLE-hSK and pCXLE-hOCT4) using the Nucleofector 2b (Lonza). Initially ...
-
bioRxiv - Biophysics 2023Quote: ... MCF7 and A375 cells (ATCC) were transfected with 1 μg DNA using the SF Cell Line 4D-Nucleofector kit (Lonza) following the manufacturer’s instructions via electroporation (4D-Nucleofector ...
-
bioRxiv - Immunology 2023Quote: ... CTLs derived from LifeAct-GFP expressing pmel-1 mice were incubated with peptide-loaded and IFNγ-treated B16 cells cultured in phenol red-free DMEM (Lonza) supplemented with 10% FBS on stage at 37°C ...
-
bioRxiv - Cell Biology 2023Quote: ... and performed nucleofection where 1 × 106 of the selected clone were resuspended in 100 μl of P3 buffer (V4XP-3024, Lonza) containing 20 μg Alt-R® S.p ...