Labshake search
Citations for Lonza :
1551 - 1600 of 1698 citations for QuantiChrom Peroxidase Assay Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2020Quote: ... Point mutations were introduced into CJ7 WT using CRISPR RNP transfected into cells with the Amaxa mouse ES kit (Lonza VPH-1001). 1×106 cells were transfected with the RNP containing two separate guide RNAs a single stranded donor oligo and a linearized puromycin resistance gene ...
-
bioRxiv - Immunology 2020Quote: ... 106 cells per condition were nucleofected with 4 µg of DNA using the Amaxa Nucleofector II (Lonza, Kit R; program R-024). Nucleofected cells were allowed to recover for 24-48 hours before sorting for GFP positivity and lack of CD56 expression.
-
bioRxiv - Microbiology 2021Quote: ... the Sleeping Beauty transposase system [37] was adapted to electroporate Jurkat cells using the Lonza SE Cell Line kit (Lonza, V4SC-1960). The pSBbi-RP plasmid was a gift from Eric Kowarz (Addgene plasmid #60513 ...
-
bioRxiv - Cell Biology 2022Quote: ... Cell lines are cultivated at 37°C with 5% CO2 and were tested every 3 months for mycoplasma contamination using Universal Mycoplasma detection kit (ATCC, 30-1012K) or MycoAlert Plus Mycoplasma Detection Ki (Lonza, LT07-701). Cell lines were used no more than 30 passages.
-
bioRxiv - Systems Biology 2022Quote: ... All cells were grown at 37°C in 5% CO2 and regularly checked for mycoplasma (MycoAlert mycoplasma detection kit, Lonza, Basel, Switzerland). Identity of all cell lines was confirmed by STR analysis (Leibniz Institute DSMZ GmbH ...
-
bioRxiv - Immunology 2019Quote: ... conjugated to FITC or GFP siRNA (300 nM) conjugated to FITC two days prior to adoptive T cell therapy using the Mouse T cell Nucleofector™ Kit (Lonza Bioscience) according to the manufacturer’s instructions.
-
bioRxiv - Immunology 2019Quote: ... as a control two days prior to adoptive T cell therapy using the P3 Primary Cell 4D-Nucleofector X™ Kit (Lonza Bioscience) according to the manufacturer’s instructions.
-
bioRxiv - Cancer Biology 2019Quote: ... 2×105 cells were co-transfected with 2ug of the Cas9/sgRNA vector PxHF1* and 4 ul of ssODN HDR template (20 uM) using a Lonza X-Unit Nucleofector with P3 buffer kit (Lonza #V4XP-3032). Four days following transfection ...
-
bioRxiv - Cell Biology 2020Quote: ... and the GFP-K17ΔNLS (Hobbs et al., 2015) were nucleofected into HeLa cells using SE Cell Line 4D X nucleofector Kit S (Lonza #V4XC-1032) with setting DS-138 ...
-
bioRxiv - Neuroscience 2021Quote: ... Single-cell suspension of hiPSCs was nucleofected with 5 μg of the generated SpCas9-sgRNA plasmid using the P3 Primary Cell 4D-Nucleofector Kit (Lonza, #V4XP-3024) in combination with the 4D Nucleofector Unit X (Lonza ...
-
bioRxiv - Microbiology 2021Quote: ... All cell lines were routinely tested for the absence of mycoplasma using the MycoAlert Plus Mycoplasma Detection Kit from Lonza (Walkersville, MD).
-
bioRxiv - Immunology 2020Quote: ... Transfection of primary T cells with Cas9 RNP complexes and TCRβα HDR templates was performed 3-4 days following activation using the 4D-Nucleofector and a 20 uL format P3 Primary Cell kit (Lonza, V4XP-3032). Briefly ...
-
bioRxiv - Microbiology 2019Quote: ... Fast-growing clonal cell lines confluent after three weeks of growth were expanded and confirmed to be mycoplasma-negative using the Myco-Alert PLUS kit (Lonza, Basel, Switzerland) prior to freezing for long-term storage in liquid nitrogen ...
-
bioRxiv - Microbiology 2019Quote: ... All parasite strains and host cell lines were routinely tested for Mycoplasma contamination with the MycoAlert Mycoplasma Detection Kit (Lonza, Basel, Switzerland) and found to be negative.
-
bioRxiv - Genomics 2021Quote: ... All the cells were grown with 5% CO2 at 37°C and verified mycoplasma free using the MycoAlert Mycoplasma Detection Kit (Lonza, LT07-218).
-
bioRxiv - Evolutionary Biology 2020Quote: ... plasmids pSpCas9n(BB)-ZEB2-Guide-A &-B (0.5 µg of each plasmid) were electroporated into 1×106 H9 cells using the Human Stem Cell Nucleofector Kit 1 (Lonza, VPH-5012). Following electroporation ...
-
bioRxiv - Molecular Biology 2020Quote: pSBbi-Pur-ABCC1 or empty vector were cotransfected with SB100X using the same Amaxa Nucleofector II and kit V (Lonza Group AG). Stably expressing cells were selected for using 10ug/mL puromycin (Gibco) ...
-
bioRxiv - Cell Biology 2021Quote: ... 5 µg of sgRNA and 5 µg of ssDNA donor template (Table S1) using Human Stem Cell NucleofectorTM kit 1 (Lonza, VVPH-5012) according to the manufactures protocol and cells replated ...
-
bioRxiv - Cancer Biology 2021Quote: ... Cells were transfected with pcDNA3.1 empty vector or pcDNA3.1 containing the human coding sequence of the VGLL2-NCOA2 fusion using the AMAXA cell line Nucleofection kit V (Lonza #VCA-1003;) and were selected in growth media containing 1μg/ml concentration of G418 (ThermoFisher #10131035) ...
-
bioRxiv - Biophysics 2021Quote: ... All cell lines were regularly tested for mycoplasma infection and were found to be negative (MycoAlert Plus Detection Kit, Lonza, LT07-710).
-
bioRxiv - Immunology 2021Quote: ... gRNA_pX335 plasmids were transfected into EL4 cells by nucleofection using an Amaxa nucleofector and the Cell Line Nucleofector Kit L (Lonza, Basel, Switzerland) according to the manufacturer’s instructions ...
-
bioRxiv - Immunology 2020Quote: ... 2 million L1.2 cells were transfected with 2 µg of plasmid using the SG Cell Line transfection kit and a 4D-Nucleofector X (both from Lonza, Walkersville, MD) following the manufacturer’s instructions ...
-
bioRxiv - Immunology 2020Quote: ... 1 × 106 BLaER1 cells were transfected with 2 μg plasmid DNA using the Human B Cell Nucleofector Kit and Nucleofector I device (program U-15; both Lonza, Basel, Schweiz). On day 2 post transfection ...
-
bioRxiv - Microbiology 2021Quote: ... All cell lines were routinely tested to confirm absence of mycoplasma using the MycoAlert Plus Mycoplasma Detection Kit from Lonza (Walkersville, MD).
-
bioRxiv - Genomics 2021Quote: ... transfection of primary T cells with Cas9 RNP complexes and GSH1/GSH2-mRuby HDR templates was performed using the 4D-Nucleofector and a 20 uL format P3 Primary Cell kit (Lonza, V4XP-3032). Briefly ...
-
bioRxiv - Neuroscience 2020Quote: ... dissociated ganglia were pelleted at 100 x g for 5 min and resuspended in 100 µl ‘Nucleofector solution’ (Rat Neuron Nucleofector kit; Lonza, Alpharetta, GA). 4-6 μg of plasmid was electroporated using the AMAXA Nucleofector device (Neurons Rat DRG ...
-
bioRxiv - Neuroscience 2020Quote: ... Single iPSCs were then nucleofected with the pX459v2 plasmid coding for the Cas9 protein and the sgRNA using P3 primary Cell 4D nucleofector kit (Lonza, V4XP-302). After nucleofection cells were plated on a 6-well plate in E8 flex medium supplemented with RevitaCell ...
-
bioRxiv - Developmental Biology 2022Quote: ... D-001206-14-05 5 nmol) and nucleofected into OPCs using the Basic Nucleofector Kit for Primary Mammalian Glial Cells (Lonza, VPI-1006) following manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2022Quote: ... Cells were co-transfected with 1 ug of firefly Luciferase vector and 0.1 ug Renilla luciferase vector by nucleofection with Lonza Cell Line Nucleofector® Kit V (Lonza, #VVCA-1003) and the T-020 program in the Amaxa Nucleofector II device ...
-
bioRxiv - Bioengineering 2022Quote: Cell cultures were monitored for the presence of mycoplasma contamination using the MycoAlert® Mycoplasma Detection Kit (Lonza #LT07-318, Basel, Switzerland) according to the manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2022Quote: Normal bronchial epithelial cells (BEAS-2B / ATCC-CRL-9609) were cultured in collagen coated flasks using the bronchial epithelial growth medium supplemented with Lonza Bullet Kit (BEGM, Lonza CC-3170), as described by ATCC culture instructions ...
-
bioRxiv - Developmental Biology 2022Quote: ... The plasmids were co-transfected into H9 hESC cells using the Amaxa 4D nucleofector (#AAF-1003B and #AAF-1003X) and the P3 Primary Cell 4D-Nucleofector X kit (Lonza, #V4XP-3024).
-
bioRxiv - Molecular Biology 2022Quote: ... using nucleofection with the Amaxa 4D-Nucleofector X-Unit and the P3 Primary Cell 4D-Nucleofector X Kit (Lonza, V4XP-3024 KT). 2×106 cells were harvested using accutase (Sigma Aldrich ...
-
bioRxiv - Microbiology 2022Quote: ... pre-coated cell culture 6-well plate with EBM-2 endothelial media supplemented with 10% FBS and a growth factor bullet kit (Lonza, Walkersville, USA) 3 mL/well ...
-
bioRxiv - Molecular Biology 2022Quote: ... HEK293T cells used in this study were confirmed to be negative for Mycoplasma Contamination and routinely tested using the MycoAlertTM Mycoplasma Detection Kit (Lonza, LT07-418). For experiments involving the SMAD4 gene ...
-
bioRxiv - Synthetic Biology 2022Quote: ... human aortic endothelial cells (CD31+) from were maintained in EGM™-2 Endothelial Cell Growth Medium-2 Bullet Kit™ (Cat # CC-3162; Lonza) and EGM™ −2 MV Microvascular Endothelial Cell Growth Medium-2 Bullet KitTM (Cat #CC-3202 ...
-
bioRxiv - Neuroscience 2023Quote: ... All cell lines used in this study were tested mycoplasma free by first culturing the cells for 3-5 days in antibiotic-free media and then subjected to a mycoplasma tested using MycoAlert™ PLUS Mycoplasma Detection Kit (Lonza, UK).
-
bioRxiv - Cell Biology 2023Quote: ... All cells were cultured at 37 °C and 5% CO2 in a humidified incubator and regularly tested for mycoplasma using the MycoAlert mycoplasma detection kit (Lonza, LT07-418).
-
bioRxiv - Neuroscience 2023Quote: ... 8 x 105 hiPSCs in single-cell suspension were nucleofected with 5 μg SpCas9-sgRNA plasmid using the P3 Primary Cell 4D-Nucleofector Kit (Lonza, #V4XP-3024) in combination with the 4D Nucleofector Unit X (Lonza ...
-
bioRxiv - Developmental Biology 2023Quote: ... ePB master vector and helper (Plasmid AW-27) were nucleofected into the established SOX2::mCitrine cell line using the P3 Primary Cell 4D-Nucleofector X Kit (Lonza; V4Xp-3012). G-418 (40ng/mL ...
-
bioRxiv - Developmental Biology 2023Quote: ... and guide RNA (Plasmid AW-P45; GTGCCCGGCACGGCCATTAA) were nucleofected in hPSCs using the P3 Primary Cell 4D-Nucleofector X Kit (Lonza; V4Xp-3012), and positive transformants were selected with blasticidin (10μg/ml ...
-
bioRxiv - Cell Biology 2023Quote: ... The cells used in this study were negatively tested for mycoplasma contamination using MycoAlert™ Mycoplasma Detection Kit (LT07-118, Lonza, Switzerland).
-
bioRxiv - Genomics 2023Quote: ... All cells were cultured with 5% CO2 at 37°C and verified to be free of mycoplasma using the MycoAlert Mycoplasma Detection Kit (Lonza, LT07-218). Wild type MCF7 cells were a gift from Howard Y ...
-
bioRxiv - Genomics 2023Quote: ... was mixed with 16.4 μL Nucleofector SolutionTM and 3.6 μL Supplement and incubated at room temperature for about 10 min according to the instruction of Amaxa 4D-Nucleofector X Kit TM (Lonza, #V4XP-3032). HepG2 ...
-
bioRxiv - Cell Biology 2023Quote: ... 100,000 MCF10a cells was nucleofected with program DS-138 using an Amaxa 4D-Nucleofector X using the SE Cell Line 4D X Kit S 32 RCT (Lonza V4XC-1032). Reactions were split between two 24-well plates and grown in complete media three days ...
-
bioRxiv - Microbiology 2023Quote: ... with 1 uL of 20 uM Cas9-NLS (UC Berkeley Macro Lab) and RNP complexes were made with SE Cell Line 96-well Nucleofector Kit (Lonza, V4SC-1096). Complexes were incubated at room temperature for ten minutes ...
-
bioRxiv - Microbiology 2023Quote: ... Guides targeting CCNT1 were complexed with 1 uL of 20 uM Cas9-NLS (UC Berkeley Macro Lab) and RNP complexes were made with SE Cell Line 96-well Nucleofector Kit (Lonza, V4SC-1096). Complexes were incubated at room temperature for ten minutes ...
-
bioRxiv - Cell Biology 2023Quote: ... All cell lines were routinely confirmed to be negative for mycoplasma by testing with a MycoAlert Mycoplasma Detection Kit (Lonza # LT07-701).
-
bioRxiv - Bioengineering 2023Quote: ... were cultured in Endothelial Cell Basal Medium (EBM) supplemented with the Endothelial Growth Media kit (EGM-2) (CC-3162, Lonza, Basel, Switzerland). All cells were maintained at 37°C and 5% CO2 and used between passage number 3-7 ...
-
bioRxiv - Microbiology 2023Quote: ... cells then were electroporated using electroporation code EH-100 and using the P3 Primary Cell 96-well Nucleofector Kit (Lonza, V4SP-3096). Knockout pools were maintained for an additional nine days prior to coculturing with H80 feeder cell line with IL-2 (Final conc 20 U/mL ...