Labshake search
Citations for Lonza :
1501 - 1550 of 1618 citations for SpectraDye Antibody Labeling Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Developmental Biology 2022Quote: ... The plasmids were co-transfected into H9 hESC cells using the Amaxa 4D nucleofector (#AAF-1003B and #AAF-1003X) and the P3 Primary Cell 4D-Nucleofector X kit (Lonza, #V4XP-3024).
-
bioRxiv - Molecular Biology 2022Quote: ... using nucleofection with the Amaxa 4D-Nucleofector X-Unit and the P3 Primary Cell 4D-Nucleofector X Kit (Lonza, V4XP-3024 KT). 2×106 cells were harvested using accutase (Sigma Aldrich ...
-
bioRxiv - Microbiology 2022Quote: ... pre-coated cell culture 6-well plate with EBM-2 endothelial media supplemented with 10% FBS and a growth factor bullet kit (Lonza, Walkersville, USA) 3 mL/well ...
-
bioRxiv - Molecular Biology 2022Quote: ... HEK293T cells used in this study were confirmed to be negative for Mycoplasma Contamination and routinely tested using the MycoAlertTM Mycoplasma Detection Kit (Lonza, LT07-418). For experiments involving the SMAD4 gene ...
-
bioRxiv - Synthetic Biology 2022Quote: ... human aortic endothelial cells (CD31+) from were maintained in EGM™-2 Endothelial Cell Growth Medium-2 Bullet Kit™ (Cat # CC-3162; Lonza) and EGM™ −2 MV Microvascular Endothelial Cell Growth Medium-2 Bullet KitTM (Cat #CC-3202 ...
-
bioRxiv - Immunology 2022Quote: LPS concentration in serum was determined using a chromogenic assay based on a Limulus amebocyte extract (LAL kit-terminal QCL1000) (LONZA, Basel, Switzerland). Samples were collected at the time of euthanasia via cardiac puncture to try to minimize as much as possible the chance of contamination ...
-
bioRxiv - Neuroscience 2023Quote: ... 8 x 105 hiPSCs in single-cell suspension were nucleofected with 5 μg SpCas9-sgRNA plasmid using the P3 Primary Cell 4D-Nucleofector Kit (Lonza, #V4XP-3024) in combination with the 4D Nucleofector Unit X (Lonza ...
-
bioRxiv - Developmental Biology 2023Quote: ... ePB master vector and helper (Plasmid AW-27) were nucleofected into the established SOX2::mCitrine cell line using the P3 Primary Cell 4D-Nucleofector X Kit (Lonza; V4Xp-3012). G-418 (40ng/mL ...
-
bioRxiv - Developmental Biology 2023Quote: ... and guide RNA (Plasmid AW-P45; GTGCCCGGCACGGCCATTAA) were nucleofected in hPSCs using the P3 Primary Cell 4D-Nucleofector X Kit (Lonza; V4Xp-3012), and positive transformants were selected with blasticidin (10μg/ml ...
-
bioRxiv - Cell Biology 2023Quote: ... The cells used in this study were negatively tested for mycoplasma contamination using MycoAlert™ Mycoplasma Detection Kit (LT07-118, Lonza, Switzerland).
-
bioRxiv - Neuroscience 2023Quote: ... All cell lines used in this study were tested mycoplasma free by first culturing the cells for 3-5 days in antibiotic-free media and then subjected to a mycoplasma tested using MycoAlert™ PLUS Mycoplasma Detection Kit (Lonza, UK).
-
bioRxiv - Cell Biology 2023Quote: ... All cells were cultured at 37 °C and 5% CO2 in a humidified incubator and regularly tested for mycoplasma using the MycoAlert mycoplasma detection kit (Lonza, LT07-418).
-
bioRxiv - Cell Biology 2023Quote: ... All cell lines were routinely confirmed to be negative for mycoplasma by testing with a MycoAlert Mycoplasma Detection Kit (Lonza # LT07-701).
-
bioRxiv - Bioengineering 2023Quote: ... were cultured in Endothelial Cell Basal Medium (EBM) supplemented with the Endothelial Growth Media kit (EGM-2) (CC-3162, Lonza, Basel, Switzerland). All cells were maintained at 37°C and 5% CO2 and used between passage number 3-7 ...
-
bioRxiv - Immunology 2023Quote: ... Purified templates together with 2 µg of LentiGuide-Gbp-Chr3-sg3+sg4 were electroporated into RAW-Cas9 cells using Lonza SF cell line X kit (Lonza, V4XC-2012) on a Lonza 4D-Nucleofector unit (Lonza) ...
-
bioRxiv - Cell Biology 2023Quote: ... 100,000 MCF10a cells was nucleofected with program DS-138 using an Amaxa 4D-Nucleofector X using the SE Cell Line 4D X Kit S 32 RCT (Lonza V4XC-1032). Reactions were split between two 24-well plates and grown in complete media three days ...
-
bioRxiv - Genomics 2023Quote: ... All cells were cultured with 5% CO2 at 37°C and verified to be free of mycoplasma using the MycoAlert Mycoplasma Detection Kit (Lonza, LT07-218). Wild type MCF7 cells were a gift from Howard Y ...
-
bioRxiv - Microbiology 2023Quote: ... with 1 uL of 20 uM Cas9-NLS (UC Berkeley Macro Lab) and RNP complexes were made with SE Cell Line 96-well Nucleofector Kit (Lonza, V4SC-1096). Complexes were incubated at room temperature for ten minutes ...
-
bioRxiv - Microbiology 2023Quote: ... Guides targeting CCNT1 were complexed with 1 uL of 20 uM Cas9-NLS (UC Berkeley Macro Lab) and RNP complexes were made with SE Cell Line 96-well Nucleofector Kit (Lonza, V4SC-1096). Complexes were incubated at room temperature for ten minutes ...
-
bioRxiv - Genomics 2023Quote: ... was mixed with 16.4 μL Nucleofector SolutionTM and 3.6 μL Supplement and incubated at room temperature for about 10 min according to the instruction of Amaxa 4D-Nucleofector X Kit TM (Lonza, #V4XP-3032). HepG2 ...
-
bioRxiv - Microbiology 2023Quote: ... cells then were electroporated using electroporation code EH-100 and using the P3 Primary Cell 96-well Nucleofector Kit (Lonza, V4SP-3096). Knockout pools were maintained for an additional nine days prior to coculturing with H80 feeder cell line with IL-2 (Final conc 20 U/mL ...
-
bioRxiv - Cancer Biology 2022Quote: ... All human cell lines were authenticated by STR analysis at the JCRB Cell Bank and tested for Mycoplasma contamination using a MycoAlert Mycoplasma Detection Kit (Lonza, Basel, Switzerland).
-
bioRxiv - Cancer Biology 2023Quote: ... All cell lines used in this study tested negative for Mycoplasma contamination via MycoAlert™ PLUS Mycoplasma Detection Kit (Lonza, Basel, Switzerland).
-
bioRxiv - Cell Biology 2023Quote: PMOs were dissolved in distilled water and transfected into RD cells using the Amaxa Cell Line Nucleofector Kit L and a Nucleofector II electroporation device (Lonza, Basel, Switzerland) with program T-030 or into cells from a DMD patient without a transfection reagent.
-
bioRxiv - Molecular Biology 2023Quote: Induced pluripotent stem cells were transfected with a total of 5 μg target Cas9/gRNA plasmids with or without 1 μg repair templates using Human Stem Cell Nucleofector Kit (LONZA, Basel, Switzerland) and Nucleofector 2b device (LONZA ...
-
bioRxiv - Biochemistry 2023Quote: ... Cells were regularly passaged 2-3 times a week and routinely tested for mycoplasma contamination using MycoAlert Plus mycoplasma Detection kit (Lonza, #LT07-710).
-
bioRxiv - Bioengineering 2023Quote: ... 100,000 cells were resuspended in 20μl P3 reagent of the P3 Primary Cell 4D-Nucleofector® X Kit S (Lonza V4XP-3032). 1 μg total plasmid was used for a single nucleofection event and nucleofected by program EH-100 ...
-
bioRxiv - Cell Biology 2023Quote: ... The linearized construct and the purified schizonts were mixed with Nucleofector solution from an Amaxa human T cell Nucleofector Kit and electroporated using the Amaxa Nucleofector II device (Lonza, Köln, Germany). Directly after transfection 50 µl RPMI-1640 complete was added to the transfection reaction followed by intravenous injection into one SWISS mouse ...
-
bioRxiv - Genomics 2023Quote: ... 200,000 cells were nucleofected with 50 fmol transposon and 50 fmol transposase (Super piggyBac Transposase - SystemBio PB210PA-1) or with 300 ng pmaxGFP using the P2 Primary Cell 4D Nucleofector kit (Lonza V4SP-2096) and the Lonza 4D- Nucleofector with the DS-150 program ...
-
bioRxiv - Microbiology 2023Quote: ... All parasite strains and host cell lines were routinely tested for mycoplasma contamination with the MycoAlert Mycoplasma Detection Kit (Lonza, Basel, Switzerland) and found to be negative.
-
bioRxiv - Genomics 2023Quote: ... Each plasmid library was transfected into K562 or A549 cells by electroporation using Lonza SF Cell Line 4D-Nucleofector X Kit (Lonza V4XC-2012) with Lonza 4D-Nucleofector ...
-
The spindle protein CKAP2 regulates microtubule dynamics and ensures faithful chromosome segregationbioRxiv - Cell Biology 2023Quote: ... and immediately transfected by Nucleofection into HT-1080 cells using the Amaxa SF Cell Line 4D-Nucleofector X kit S (Lonza, PBC2-00675) and either program FF-113 (HT1080 ...
-
bioRxiv - Genetics 2023Quote: ... The media was removed from the cell pellet and cells were resuspended according to the protocol provided for the P3 Primary Cell 4D-Nucleofector Kit (Lonza, V4XP-3024). Briefly ...
-
bioRxiv - Cell Biology 2023Quote: ... Cell lines were cultured in a humidified incubator at 37°C and 5% CO2 and regularly tested for mycoplasma using the MycoAlert mycoplasma detection kit (Lonza, LT07-418).
-
bioRxiv - Cancer Biology 2023Quote: ... All cell lines were authenticated by STR profiling (Eurofins, Val Fleuri, Luxembourg) and were tested negative for mycoplasma (MycoAlert PLUS mycoplasma detection kit, Lonza, Basel, Switzerland).
-
bioRxiv - Immunology 2023Quote: ... Constructs were transiently transfected into KRT17 null A431 cells using the SF Cell Line 4D-Nucleofector™ X Kit (Lonza #V4XC-2032) and Lonza 4D-nucleofector X unit “A431 cell” program ...
-
bioRxiv - Developmental Biology 2024Quote: ... Cells were resuspended in 20 µl nucleofection buffer (16.4 µl Nucleofector® Solution + 3.6 µl Supplement) provided in P3 Primary Cell 4D-Nucleofector™ X Kit S (Lonza, V4XP-3032). After the addition of 3 µl RNP and 0.5 µl of Alt-R Cas9 Electroporation Enhancer (IDT ...
-
bioRxiv - Genomics 2024Quote: ... were complexed for 20 minutes at room temperature and were nucleofected into 5E5 PEmax parental cells using the SE Cell Line 4D-Nucleofector X Kit (Lonza V4XC-1032) and program FF-120 ...
-
bioRxiv - Developmental Biology 2024Quote: ... 1.5 x 106 cells were transfected with 1 µg DNA (500 ng Cas9 plasmid and 500 ng linearized donor plasmid) by nucleofection (pulse code CA137) using P3 Primary Cell 4D-Nucleofector X kit (Lonza, V4XP-3024) in a 4D-Nucleofector (Lonza ...
-
bioRxiv - Synthetic Biology 2024Quote: Electroporation was done 7 days after stimulation by DynaBeads using a P3 Primary Cell 4D-Nucleofector™ X Kit (Lonza #V4XP-3012). 750 ng of HDR template was mixed with 50 pmol of RNP and incubated at room temperature for 10 minutes ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... and the cell pellet was resuspended in Keratinocyte Growth Medium-2 Bullet Kit (KGM2 medium) consisting of KGM-2 Basal Medium and KGM-2 SingleQuots Supplements (Lonza, Basel, Switzerland), and then seeded onto Petri dishes coated with collagen IV ...
-
bioRxiv - Cell Biology 2024Quote: ... coated tissue culture polystyrene (TCPS) and maintained at 37° Celsius and 5% CO2 in endothelial growth medium (EGM-2 with bullet kit; Lonza, CC-3162) supplemented with 1% penicillin/streptomycin (Corning ...
-
bioRxiv - Immunology 2023Quote: ... T cells were then rinsed with PBS and 10 × 106 cells were resuspended in 20 µl of P4 primary cell nucleofection solution (P4 Primary Cell 4D-Nucleofector X Kit S, Lonza V4XP-4032). 20 μL of resuspended T cells were then gently mixed with 5 µL of RNP complex and incubated for 2 minutes at room temperature ...
-
bioRxiv - Molecular Biology 2023Quote: ... MCF-10A human mammary gland cells were used as the non-tumorigenic control and were cultured in MEBM basal medium supplemented with components included in the MEGMTM Mammary Epithelial Cell Growth Medium SingleQuotsTM Kit (Lonza, Hayward, CA). A549 human lung carcinoma cells were cultured in Dulbecco’s Modified Eagles Medium (DMEM ...
-
bioRxiv - Molecular Biology 2024Quote: ... Cell lines were routinely monitored to ensure the absence of Mycoplasma contamination using the MycoAlert PLUS Mycoplasma Detection Kit (Lonza #LT07-705).
-
bioRxiv - Molecular Biology 2024Quote: ... The culture medium or the DNA harvested from the cultures were tested for mycoplasma contamination using a MycoAlert Mycoplasma Detection Kit (Lonza, LT07-418) or e-Myco PLUS PCR Detection Kit (BOCA scientific ...
-
bioRxiv - Genomics 2024Quote: ... and electroporated with 6 μg of gRNA-Cas9 expression vector and 3 μg of SNRPN targeting vector using the P3 Primary Cell 4D-Nucleofector Kit (Lonza, V4XP-3032). Transfected cells were plated into a 10 cm dish coated with Matrigel (Corning ...
-
bioRxiv - Cancer Biology 2024Quote: ... All cells were cultured at 37 °C in 5% CO2 humidity and were tested routinely for mycoplasma using MycoAlert mycoplasma detection kit (Lonza, LT07-318) and appropriate positive control (Lonza ...
-
Macropinocytosis mediates resistance to loss of glutamine transport in triple-negative breast cancerbioRxiv - Cancer Biology 2024Quote: ... All cell lines were tested and negative for mycoplasma contamination by staff at the Mycoplasma Testing Facility (UNSW Sydney, Sydney, Australia) using the MycoAlertTM Mycoplasma Detection Kit (Lonza, Basel, Switzerland) every three months.
-
bioRxiv - Cancer Biology 2024Quote: ... Cell lines were validated by sequencing to contain KRAS and TP53 mutations and verified as Mycoplasma negative (MycoAlert Mycoplasma Detection Kit, Lonza, LT07-701). All cells were maintained in monolayer culture at 37°C and 5% CO2 ...