Labshake search
Citations for Lonza :
1501 - 1550 of 2363 citations for Mouse Oxidation resistance protein 1 Oxr1 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2022Quote: ... Cell lines were periodically tested to confirm Mycoplasma negativity using the MycoAlert mycoplasma Detection Kit (Lonza, Visp, Switzerland). Detailed methods for additional cell lines derived from solid tumors and leukemia are provided in Supplementary Materials and Methods.
-
bioRxiv - Molecular Biology 2023Quote: ... All cell lines were routinely tested for mycoplasma contamination by the MycoAlert Mycoplasma Detection Kit (Lonza #LT07-318).
-
bioRxiv - Immunology 2023Quote: ... The MPRA vector library was nucleofected into TPP macrophages (5µg vector into 5×106 cells) in 100μl nucleofection buffer (Human Macrophage Nucleofection Kit, Lonza) using a Nucleofector 2b (program Y-011) ...
-
bioRxiv - Developmental Biology 2023Quote: ... or pcDNA3.1(-) as a control using the AMAXA SG Cell line kit (4D-Nucleofector program EO-100; Lonza). Cells were further cultivated in DMEM/F12 supplemented with 10% FBS (Sigma ...
-
bioRxiv - Immunology 2023Quote: ... beads were removed on day 3 followed by electroporation using the Human T Cell Nucleofector™ Kit (Lonza) and the Amaxa Nucleofactor® 2b (Lonza ...
-
bioRxiv - Neuroscience 2023Quote: ... CRISPR reagents were transfected into iPSCs using the P3 Primary Cell 4D Nucleofector™ X Kit S (Lonza), as previously described (Deneault et al. ...
-
bioRxiv - Molecular Biology 2023Quote: ... and resuspended carefully in 20ul 4D-Nucleofector™ Solution (SE Cell Line 4D-Nucleofector™ X Kit, Lonza). Thereafter ...
-
bioRxiv - Immunology 2023Quote: ... The P14 cell/Cas9/RNP mixes were transferred to Nucleofection cuvette strips (4D-Nucleofector X kit S; Lonza). Cells were electroporated using a 4D nucleofector (4D-Nucleofector Core Unit ...
-
A spatially resolved EGFR signaling model predicts the length scale of GAB1-SHP2 complex persistencebioRxiv - Systems Biology 2023Quote: ... Cells were confirmed to be mycoplasma-negative using the MycoAlert Mycoplasma Detection Kit (LT07-318; Lonza, Basel, Switzerland).
-
bioRxiv - Cancer Biology 2023Quote: ... All cell lines were tested negative for mycoplasma contamination with MycoAlert® Mycoplasma Detection Kit (Lonza, LT07-118).
-
bioRxiv - Cell Biology 2023Quote: ... dermal fibroblasts were expanded and verified mycoplasm negative via MycoAlert™ PLUS Mycoplasma Detection Kit (Lonza, 75860-362) infected with Sendai virus containing Yamanaka factors from the CytoTune™-iPS 2.0 Sendai Reprogramming Kit (ThermoFisher ...
-
bioRxiv - Cell Biology 2023Quote: ... All human cell lines were tested for Mycoplasma contamination using a MycoAlert Mycoplasma Detection Kit (Lonza, Basel, Switzerland).
-
bioRxiv - Cell Biology 2023Quote: PC12 cells were transfected with 300 nM siRNA by electroporation using the Cell Line Nucleofector Kit V (Lonza), following the manufacturer’s instructions ...
-
Hallmark molecular and pathological features of POLG disease are recapitulated in cerebral organoidsbioRxiv - Cell Biology 2023Quote: ... Regular monitoring for mycoplasma contamination was performed using the Myco Alert™ Mycoplasma Detection Kit (Lonza, #LT07-218) to ensure the integrity of the cell lines.
-
bioRxiv - Immunology 2024Quote: ... 16.4µl P3 and 3.6µl Supplement Reaction solutions from P3 Primary Cell 4D X Kit S (Lonza V4XP-3032) were added ...
-
bioRxiv - Biochemistry 2023Quote: ... Cell lines were tested once a month for mycoplasma contamination using Mycoalert® Detection Kit (Lonza, Basel, Switzerland). MCF7 and MDA-468 cells were grown in RPMI 1640 medium (Thermo Fisher Scientific ...
-
bioRxiv - Synthetic Biology 2024Quote: ... and Jurkat cell lines tested negative for mycoplasma with the MycoAlert Mycoplasma Detection Kit (Lonza Cat #LT07-318).
-
Vps18 contributes to phagosome membrane integrity in Mycobacterium tuberculosis-infected macrophagesbioRxiv - Microbiology 2023Quote: ... and nucleofection was performed as per the manufacturer’s recommendations (Lonza, SG Cell Line 4D-Nucleofector X Kit S). Monoclonal isolation of the knockouts were performed by limiting dilution ...
-
bioRxiv - Molecular Biology 2024Quote: ... iMEPM cells were tested for mycoplasma contamination using the MycoAlert Mycoplasma Detection Kit (Lonza Group Ltd, Basel, Switzerland). Packaged lentiviruses containing pLV[shRNA]-EGFP:T2A:Puro-U6>Scramble_shRNA (vectorID ...
-
bioRxiv - Neuroscience 2024Quote: ... we used the 4D-Nucleofector system and Amaxa P3 primary Cell 4D-Nucleofector X Kit S from Lonza. The electroporation buffer used was P3 primary cell Nucleofector Solution with Supplement 1 (Lonza) ...
-
bioRxiv - Molecular Biology 2024Quote: ... siRNA transfections were performed using the 4D-Nucleofector and the SE cell line 4D-Nucleofector X kits (Lonza) according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2024Quote: ... containing the appropriate guide RNA (gRNA) sequences (CGCTCAACTCGGCCATGCGC; GCAACAGATGGAAGGCCTCC) using the AmaxaTM nucleofectorTM kit V (Lonza #VCA-1003). Monoclonal lines were screened for puromycin sensitivity ...
-
bioRxiv - Developmental Biology 2021Quote: ... The resulting mixture was electrophoresed in NuSieve 3:1 agarose (Lonza 50091), and fragments sized 150-350 bp were excised and then purified using a MinElute Gel Extraction kit (QIAGEN 28604) ...
-
bioRxiv - Microbiology 2019Quote: ... and then 1 ml of SMEM complete medium [MEM Eagle Joklik (Lonza), 10% TBP ...
-
bioRxiv - Developmental Biology 2021Quote: ... sperm fraction was diluted 1:10 in Phosphate Buffered Saline (PBS, Lonza) and CellROX reagents (1 μM/μl ...
-
bioRxiv - Bioengineering 2020Quote: ... The cell suspension contained a 2:1 ratio of GFP-HUVECs (Lonza) and HDFs ...
-
bioRxiv - Cell Biology 2021Quote: ... 1×105 singularized cells were resuspended in 100μl of nucleofector solution (Lonza) containing 10 g of each sgRNA (#1 and #2 modified sgRNAs ...
-
bioRxiv - Developmental Biology 2022Quote: ... embryos and larvae were immobilized in 1% low-melting point agarose (Lonza) containing 0.016% tricaine and positioned in Fluoro-Dish glass bottom dishes (WorldPrecisition Instruments) ...
-
bioRxiv - Cancer Biology 2022Quote: ... and QGP-1 cells were grown in RPMI 1640 (Lonza, Basel, Switzerland), both supplemented with 10 % fetal bovine serum (FBS ...
-
bioRxiv - Cancer Biology 2022Quote: ... THP-1 cells and their derivatives were cultured in RPMI media (Lonza) supplemented with 10% FBS ...
-
bioRxiv - Cancer Biology 2020Quote: ... All media were supplemented with 1 mM sodium pyruvate (Lonza #BW13-115E), 2 mM L-glutamine (Gibco #25030081) ...
-
bioRxiv - Physiology 2020Quote: ... Digestion was stopped with 1 ml culture medium containing 80% DMEM (Lonza), 10% BCS (Hylcone) ...
-
bioRxiv - Cancer Biology 2020Quote: ... and blocked for 1 h at RT in PBS (Lonza, Basel, Switzerland) containing 5% FBS and 0.2% Triton X-100 ...
-
bioRxiv - Microbiology 2021Quote: ... with 1% of L-Glutamine (200 mM) (Lonza Cat. No: BE17-605E), HCC-78 in RPMI-1640 (Sigma Cat ...
-
bioRxiv - Cell Biology 2020Quote: ... an additional erythrocyte lysis step with 1 ml ACK lysing buffer (Lonza) for 10 min ...
-
bioRxiv - Cell Biology 2020Quote: ... Cell lines were passaged with 1 × Trypsin-EDTA (Lonza, UK cat: T3924). All cell lines tested negative for Mycoplasma and all were authenticated in-house (CRUK-Manchester Institute ...
-
bioRxiv - Immunology 2021Quote: ... Cells were harvested on day 7 with 1 X PBS EDTA (Lonza).
-
bioRxiv - Immunology 2022Quote: ... 1×106 CD8+ T cells were re-suspended in P3 buffer (Lonza) containing RNP complex and enhancer DNA (IDT ...
-
bioRxiv - Microbiology 2022Quote: ... 1×104 HUVECs were cultured in EGM2 or dilution with EBM2 (Lonza). Apoptotic cells were stained with ViaStain Live Caspase 3/7 kit (Nexcelom ...
-
bioRxiv - Neuroscience 2022Quote: ... 1% v/v L-glutamine and penicillin/streptomycin (Lonza, cat# DE17-603E), at 37°C in 5% CO2.
-
bioRxiv - Molecular Biology 2023Quote: ... and 1% antibiotics (10000 U/ml penicillin, 10000 µg/ml streptomycin, Lonza). The cells were incubated in a humidified atmosphere at 37°C with 5% CO2.
-
bioRxiv - Cell Biology 2022Quote: ... 1 ug PX459 plasmid and blasticidin-expressing plasmid in Amaxa buffer (Lonza) with 100 mM ATP ...
-
bioRxiv - Cancer Biology 2023Quote: For USP18 KO LAPSE 1 × 106 cells were electroporated (Lonza, 4D-Nucleofactor) using the following electroporation buffers and protocols ...
-
bioRxiv - Microbiology 2023Quote: ... The RNA was loaded onto a 2% NuSieve 3:1 agarose (Lonza), 1X MOPS ...
-
bioRxiv - Microbiology 2023Quote: ... each 20 μL reaction contained 1X SYBR Green 1 (Lonza, Cat. # 50513), 1X Thermopol Reaction Buffer (NEB ...
-
bioRxiv - Neuroscience 2023Quote: ... the cultures were incubated with 1 mL of L7 dissociation solution (Lonza) for 2 minutes ...
-
bioRxiv - Developmental Biology 2023Quote: ... and 1 μg of sgRNA-CAS9 expression vector by 4D-Nucleofector (Lonza) using P3 Primary Cell 4D-Nucleofector X kit (Lonza) ...
-
Essential roles of the ANKRD31-REC114 interaction in meiotic recombination and mouse spermatogenesisbioRxiv - Genetics 2023Quote: Cells were embedded in plugs of 1% low-melting-point agarose (Lonza) in GBSS (1.5 million to 2 million cells per plug) ...
-
bioRxiv - Microbiology 2024Quote: ... 4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid (HEPES) 25 mM (Lonza, 17-737F), gentamicin 25 μg/ml (Lonza ...
-
bioRxiv - Biochemistry 2024Quote: ... 1 x Basal Medium Eagle Vitamins (100x stock; VWR/Lonza #733-1801), 2 mM MgSO4 ...