Labshake search
Citations for Lonza :
1501 - 1550 of 2449 citations for Chicken Metallothionein 1 MT1 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2020Quote: ... All media were supplemented with 1 mM sodium pyruvate (Lonza #BW13-115E), 2 mM L-glutamine (Gibco #25030081) ...
-
bioRxiv - Physiology 2020Quote: ... Digestion was stopped with 1 ml culture medium containing 80% DMEM (Lonza), 10% BCS (Hylcone) ...
-
bioRxiv - Cancer Biology 2020Quote: ... and blocked for 1 h at RT in PBS (Lonza, Basel, Switzerland) containing 5% FBS and 0.2% Triton X-100 ...
-
bioRxiv - Microbiology 2021Quote: ... with 1% of L-Glutamine (200 mM) (Lonza Cat. No: BE17-605E), HCC-78 in RPMI-1640 (Sigma Cat ...
-
bioRxiv - Cell Biology 2020Quote: ... an additional erythrocyte lysis step with 1 ml ACK lysing buffer (Lonza) for 10 min ...
-
bioRxiv - Cell Biology 2020Quote: ... Cell lines were passaged with 1 × Trypsin-EDTA (Lonza, UK cat: T3924). All cell lines tested negative for Mycoplasma and all were authenticated in-house (CRUK-Manchester Institute ...
-
bioRxiv - Immunology 2021Quote: ... Cells were harvested on day 7 with 1 X PBS EDTA (Lonza).
-
bioRxiv - Immunology 2022Quote: ... 1×106 CD8+ T cells were re-suspended in P3 buffer (Lonza) containing RNP complex and enhancer DNA (IDT ...
-
bioRxiv - Microbiology 2022Quote: ... 1×104 HUVECs were cultured in EGM2 or dilution with EBM2 (Lonza). Apoptotic cells were stained with ViaStain Live Caspase 3/7 kit (Nexcelom ...
-
bioRxiv - Neuroscience 2022Quote: ... 1% v/v L-glutamine and penicillin/streptomycin (Lonza, cat# DE17-603E), at 37°C in 5% CO2.
-
bioRxiv - Molecular Biology 2023Quote: ... and 1% antibiotics (10000 U/ml penicillin, 10000 µg/ml streptomycin, Lonza). The cells were incubated in a humidified atmosphere at 37°C with 5% CO2.
-
bioRxiv - Cell Biology 2022Quote: ... 1 ug PX459 plasmid and blasticidin-expressing plasmid in Amaxa buffer (Lonza) with 100 mM ATP ...
-
bioRxiv - Microbiology 2024Quote: ... 4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid (HEPES) 25 mM (Lonza, 17-737F), gentamicin 25 μg/ml (Lonza ...
-
bioRxiv - Biochemistry 2024Quote: ... 1 x Basal Medium Eagle Vitamins (100x stock; VWR/Lonza #733-1801), 2 mM MgSO4 ...
-
bioRxiv - Cancer Biology 2023Quote: For USP18 KO LAPSE 1 × 106 cells were electroporated (Lonza, 4D-Nucleofactor) using the following electroporation buffers and protocols ...
-
bioRxiv - Microbiology 2023Quote: ... The RNA was loaded onto a 2% NuSieve 3:1 agarose (Lonza), 1X MOPS ...
-
bioRxiv - Microbiology 2023Quote: ... each 20 μL reaction contained 1X SYBR Green 1 (Lonza, Cat. # 50513), 1X Thermopol Reaction Buffer (NEB ...
-
bioRxiv - Neuroscience 2023Quote: ... the cultures were incubated with 1 mL of L7 dissociation solution (Lonza) for 2 minutes ...
-
bioRxiv - Developmental Biology 2023Quote: ... and 1 μg of sgRNA-CAS9 expression vector by 4D-Nucleofector (Lonza) using P3 Primary Cell 4D-Nucleofector X kit (Lonza) ...
-
Essential roles of the ANKRD31-REC114 interaction in meiotic recombination and mouse spermatogenesisbioRxiv - Genetics 2023Quote: Cells were embedded in plugs of 1% low-melting-point agarose (Lonza) in GBSS (1.5 million to 2 million cells per plug) ...
-
bioRxiv - Cancer Biology 2024Quote: Trypan Blue 0.4% solution (dilute 1:8 in PBS 1X; #17492E, Lonza)
-
bioRxiv - Cell Biology 2020Quote: ... or a FOXO1-targeted siRNA (GAGCGUGCCCUACUUCAAGGA) using the Amaxa(tm) Basic Nucleofector(tm) Kit for Primary Mammalian Fibroblasts (Lonza), according to the manufacturer’s protocol ...
-
bioRxiv - Genetics 2021Quote: ... Two million WTC iPSC were nucleofected using an Amaxa nucleofector 2B and the Nucleofector Kit C (both from Lonza), 0.5 µg of each AAVS1 TALEN pair and 1 µg of the donor plasmid (see Figure S4) ...
-
bioRxiv - Microbiology 2021Quote: ... All the cells used in this study tested negative for mycoplasma contamination using MycoAlert™ Mycoplasma detection kit (Lonza).
-
bioRxiv - Molecular Biology 2021Quote: ... siRNA transfections were performed using the 4D-Nucleofector and the SE cell line 4D-Nucleofector X kit L (Lonza) according to the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2021Quote: ... Cellular ATP levels were detected 20 h after glutamate exposure using the ViaLight™ Plus-Kit (Lonza, Verviers, Belgium) following the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2021Quote: ... The cell density was counted and ∼2.5 × 105 cells were transfected with indicated constructs by using P3 Primary Cell 4D-Nucleofector X kit (Lonza). After transfection ...
-
bioRxiv - Immunology 2020Quote: ... All cells were confirmed to be free of mycoplasmas before injection into mice by the MycoAlert detection kit (Lonza). Tumor growth was monitored using an electronic caliper and volumes were determined using the following formula ...
-
bioRxiv - Genomics 2019Quote: The input library plasmids were electroporated into the K562 cells with Cell Line Nucleofector Kit V (Lonza, VCA-1003). For each electroporation ...
-
bioRxiv - Microbiology 2020Quote: ... Cell lines were authenticated by morphologic evaluation and were checked for mycoplasma contamination (MycoAlertTM PLUS Mycoplasma Detection Kit, Lonza).
-
bioRxiv - Genetics 2019Quote: ... Hela cells were electroporated with plasmids using Ingenio electroporation kit (SopaChem) and the Nucleofector™ II/2b device (Lonza). Cells were harvested 24h post-electroporation ...
-
bioRxiv - Developmental Biology 2020Quote: ... Cells were transfected using the P3 Primary Cell 4D-Nucleofector™ X Kit S (Lonza-BioResearch, Cat #: V4XP-3032) and Amaxa™ 4D-Nucleofector™ (Lonza-BioResearch) ...
-
bioRxiv - Cell Biology 2019Quote: ... The cells were then mixed with 100uL of SE Cell Line 4D-Nucleofector® X Kit (Lonza, Basel, Switzerland) and transfected with 65nM siRNA diluted in MilliQ sterile-filtered water using the 4D-Nucleofector (Lonza ...
-
bioRxiv - Immunology 2019Quote: ... Pre-activated B cells were transfected using the P4 Primary Cell 4D-Nucleofector X Kit L (Lonza, V4XP-4024) in combination with the program DI-100 ...
-
bioRxiv - Immunology 2019Quote: ... Endotoxin concentrations were measured in all protein samples using the Limulus Amebocyte Lysate Kit – QCL-1000 (Lonza, Basel, Switzerland). The rMIC1 ...
-
bioRxiv - Developmental Biology 2021Quote: ... pPBCAG-hph and a PiggyBac Transposase vector using the AMAXA Mouse Embryonic Stem Cell Nucleofector Kit (LONZA, VPH-1001). Transfected cells were selected with 200 μg/ml hygromycin B Gold (Ibian tech. ...
-
bioRxiv - Developmental Biology 2021Quote: ... 5×106 EL16.7 TST ESCs were nucleofected with the AMAXA Mouse Embryonic Stem Cell Nucleofector Kit (LONZA, VPH-1001) using program A-30 with 1.6 µg each of GFP and tdTomato circularised targeting vectors and 5 µg single gRNA vector PX459 (5’-TATACCTAATCATTATGCCG-3’ ...
-
bioRxiv - Immunology 2021Quote: ... The siRNA duplexes were used to transfect purified human naïve B cells using the Human B Cell NucleofectorTM Kit (VPA-1001, LONZA). Transfected B cells were then stimulated with CpG ODN 2395 plus IL-2 and IL-21 for 96 h before genomic DNA extraction for analysis of Sμ-σδand Sμ-Sγ1 DNA recombination ...
-
bioRxiv - Neuroscience 2020Quote: ... 2×105 dissociated neurons were transfected with Lonza Nucleofector using the Basic Neuron SCN Nucleofector kit (Lonza, Basel, Switzerland). Transfected neurons were incubated for indicating days and processed for subsequent analyses.
-
bioRxiv - Cancer Biology 2021Quote: ... The siRNA transfections for primary BMDMs and pancreatic fibroblasts were performed using the Mouse Macrophage Nucleofector™ Kit (Lonza) and Nucleofector™ 2b Device (Lonza ...
-
bioRxiv - Cancer Biology 2020Quote: ... E4ORF1-transduced primary human umbilical vein endothelial cells (HUVECs) were cultured using the EGM-2 Bullet Kit (Lonza, Germany). All cell lines were kept at 37°C and 5% CO2 in a fully humidified incubator and negatively tested for mycoplasma by PCR.
-
bioRxiv - Microbiology 2021Quote: ... berghei ANKA using the parasite nucleofector II kit and the Nucleofector II device with the U-033 program (Lonza). Transfected parasites were injected intravenously into 5 - 7 weeks old female ddY mice ...
-
bioRxiv - Microbiology 2021Quote: ... Relative adenylate kinase levels were measured on 40μL of supernatants via the ToxiLightTM Non-Destructive Cytotoxicity BioAssay Kit (Lonza) according to the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2020Quote: ... pCAGIG-hA3A-BE3 plasmid was delivered into cells using SF Cell Line 4D-Nucleofector X Kit (Lonza, #V4XC-2032) using programme CA-137 ...
-
bioRxiv - Bioengineering 2020Quote: ... Cells were routinely tested for mycoplasma every 6 months to ensure cell quality (MycoAlert™ Mycoplasma Detection Kit; Lonza).
-
bioRxiv - Neuroscience 2022Quote: ... 1 x 106 NSCs were mixed with 2.5 µg of corresponding DNA using Amaxa P4 Primary Cell 4D-Nucleofector X Kit S (Lonza) with CA137 programme in a 4D-Nucleofector X Unit (Lonza) ...
-
bioRxiv - Cancer Biology 2022Quote: ... 5 μg of DNA was used to transfect the cells using the Amaxa Cell Line Nucleofector kit (Lonza Bioscience) according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2022Quote: ... 300 pmol of HDR oligonucleotide was electroporated into one million HEK293 Flp-In T-Rex cells along with 2.5 μg each of pSpCas9(BB)-2A-Puro and BiP gRNA plasmid (Amaxa kit R, program A-24; Lonza). Immediately after electroporation ...
-
bioRxiv - Molecular Biology 2022Quote: ... All cells were free of Mycoplasma contamination as confirmed by routine testing using the MycoAlert Mycoplasma Detection Kit (Lonza).
-
bioRxiv - Microbiology 2022Quote: ... and resuspended in 100 μL nucleofector solution at a concentration of 1.5 x 106 cells/100 μl following the instructions of the Nucleofector Kit V (Lonza). In vitro transcribed RNA (5 μg ...