Labshake search
Citations for Lonza :
1451 - 1500 of 2334 citations for Cow Upstream stimulatory factor 1 USF1 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Synthetic Biology 2024Quote: ... and Jurkat cell lines tested negative for mycoplasma with the MycoAlert Mycoplasma Detection Kit (Lonza Cat #LT07-318).
-
bioRxiv - Neuroscience 2024Quote: ... we used the 4D-Nucleofector system and Amaxa P3 primary Cell 4D-Nucleofector X Kit S from Lonza. The electroporation buffer used was P3 primary cell Nucleofector Solution with Supplement 1 (Lonza) ...
-
bioRxiv - Cell Biology 2024Quote: ... containing the appropriate guide RNA (gRNA) sequences (CGCTCAACTCGGCCATGCGC; GCAACAGATGGAAGGCCTCC) using the AmaxaTM nucleofectorTM kit V (Lonza #VCA-1003). Monoclonal lines were screened for puromycin sensitivity ...
-
bioRxiv - Molecular Biology 2024Quote: ... siRNA transfections were performed using the 4D-Nucleofector and the SE cell line 4D-Nucleofector X kits (Lonza) according to the manufacturer’s instructions ...
-
bioRxiv - Immunology 2024Quote: ... 16.4µl P3 and 3.6µl Supplement Reaction solutions from P3 Primary Cell 4D X Kit S (Lonza V4XP-3032) were added ...
-
bioRxiv - Developmental Biology 2021Quote: ... The resulting mixture was electrophoresed in NuSieve 3:1 agarose (Lonza 50091), and fragments sized 150-350 bp were excised and then purified using a MinElute Gel Extraction kit (QIAGEN 28604) ...
-
bioRxiv - Microbiology 2019Quote: ... and then 1 ml of SMEM complete medium [MEM Eagle Joklik (Lonza), 10% TBP ...
-
bioRxiv - Developmental Biology 2021Quote: ... sperm fraction was diluted 1:10 in Phosphate Buffered Saline (PBS, Lonza) and CellROX reagents (1 μM/μl ...
-
bioRxiv - Bioengineering 2020Quote: ... The cell suspension contained a 2:1 ratio of GFP-HUVECs (Lonza) and HDFs ...
-
bioRxiv - Cell Biology 2021Quote: ... 1×105 singularized cells were resuspended in 100μl of nucleofector solution (Lonza) containing 10 g of each sgRNA (#1 and #2 modified sgRNAs ...
-
bioRxiv - Developmental Biology 2022Quote: ... embryos and larvae were immobilized in 1% low-melting point agarose (Lonza) containing 0.016% tricaine and positioned in Fluoro-Dish glass bottom dishes (WorldPrecisition Instruments) ...
-
bioRxiv - Cancer Biology 2022Quote: ... and QGP-1 cells were grown in RPMI 1640 (Lonza, Basel, Switzerland), both supplemented with 10 % fetal bovine serum (FBS ...
-
bioRxiv - Cancer Biology 2022Quote: ... THP-1 cells and their derivatives were cultured in RPMI media (Lonza) supplemented with 10% FBS ...
-
bioRxiv - Cancer Biology 2020Quote: ... All media were supplemented with 1 mM sodium pyruvate (Lonza #BW13-115E), 2 mM L-glutamine (Gibco #25030081) ...
-
bioRxiv - Physiology 2020Quote: ... Digestion was stopped with 1 ml culture medium containing 80% DMEM (Lonza), 10% BCS (Hylcone) ...
-
bioRxiv - Cancer Biology 2020Quote: ... and blocked for 1 h at RT in PBS (Lonza, Basel, Switzerland) containing 5% FBS and 0.2% Triton X-100 ...
-
bioRxiv - Microbiology 2021Quote: ... with 1% of L-Glutamine (200 mM) (Lonza Cat. No: BE17-605E), HCC-78 in RPMI-1640 (Sigma Cat ...
-
bioRxiv - Cell Biology 2020Quote: ... an additional erythrocyte lysis step with 1 ml ACK lysing buffer (Lonza) for 10 min ...
-
bioRxiv - Cell Biology 2020Quote: ... Cell lines were passaged with 1 × Trypsin-EDTA (Lonza, UK cat: T3924). All cell lines tested negative for Mycoplasma and all were authenticated in-house (CRUK-Manchester Institute ...
-
bioRxiv - Immunology 2021Quote: ... Cells were harvested on day 7 with 1 X PBS EDTA (Lonza).
-
bioRxiv - Immunology 2022Quote: ... 1×106 CD8+ T cells were re-suspended in P3 buffer (Lonza) containing RNP complex and enhancer DNA (IDT ...
-
bioRxiv - Microbiology 2022Quote: ... 1×104 HUVECs were cultured in EGM2 or dilution with EBM2 (Lonza). Apoptotic cells were stained with ViaStain Live Caspase 3/7 kit (Nexcelom ...
-
bioRxiv - Neuroscience 2022Quote: ... 1% v/v L-glutamine and penicillin/streptomycin (Lonza, cat# DE17-603E), at 37°C in 5% CO2.
-
bioRxiv - Molecular Biology 2023Quote: ... and 1% antibiotics (10000 U/ml penicillin, 10000 µg/ml streptomycin, Lonza). The cells were incubated in a humidified atmosphere at 37°C with 5% CO2.
-
bioRxiv - Cell Biology 2022Quote: ... 1 ug PX459 plasmid and blasticidin-expressing plasmid in Amaxa buffer (Lonza) with 100 mM ATP ...
-
bioRxiv - Developmental Biology 2023Quote: ... and 1 μg of sgRNA-CAS9 expression vector by 4D-Nucleofector (Lonza) using P3 Primary Cell 4D-Nucleofector X kit (Lonza) ...
-
bioRxiv - Cancer Biology 2023Quote: For USP18 KO LAPSE 1 × 106 cells were electroporated (Lonza, 4D-Nucleofactor) using the following electroporation buffers and protocols ...
-
bioRxiv - Microbiology 2023Quote: ... The RNA was loaded onto a 2% NuSieve 3:1 agarose (Lonza), 1X MOPS ...
-
bioRxiv - Microbiology 2023Quote: ... each 20 μL reaction contained 1X SYBR Green 1 (Lonza, Cat. # 50513), 1X Thermopol Reaction Buffer (NEB ...
-
bioRxiv - Neuroscience 2023Quote: ... the cultures were incubated with 1 mL of L7 dissociation solution (Lonza) for 2 minutes ...
-
Essential roles of the ANKRD31-REC114 interaction in meiotic recombination and mouse spermatogenesisbioRxiv - Genetics 2023Quote: Cells were embedded in plugs of 1% low-melting-point agarose (Lonza) in GBSS (1.5 million to 2 million cells per plug) ...
-
bioRxiv - Microbiology 2024Quote: ... 4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid (HEPES) 25 mM (Lonza, 17-737F), gentamicin 25 μg/ml (Lonza ...
-
bioRxiv - Biochemistry 2024Quote: ... 1 x Basal Medium Eagle Vitamins (100x stock; VWR/Lonza #733-1801), 2 mM MgSO4 ...
-
bioRxiv - Cell Biology 2020Quote: ... or a FOXO1-targeted siRNA (GAGCGUGCCCUACUUCAAGGA) using the Amaxa(tm) Basic Nucleofector(tm) Kit for Primary Mammalian Fibroblasts (Lonza), according to the manufacturer’s protocol ...
-
bioRxiv - Genetics 2021Quote: ... Two million WTC iPSC were nucleofected using an Amaxa nucleofector 2B and the Nucleofector Kit C (both from Lonza), 0.5 µg of each AAVS1 TALEN pair and 1 µg of the donor plasmid (see Figure S4) ...
-
bioRxiv - Microbiology 2021Quote: ... All the cells used in this study tested negative for mycoplasma contamination using MycoAlert™ Mycoplasma detection kit (Lonza).
-
bioRxiv - Molecular Biology 2021Quote: ... siRNA transfections were performed using the 4D-Nucleofector and the SE cell line 4D-Nucleofector X kit L (Lonza) according to the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2021Quote: ... Cellular ATP levels were detected 20 h after glutamate exposure using the ViaLight™ Plus-Kit (Lonza, Verviers, Belgium) following the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2021Quote: ... The cell density was counted and ∼2.5 × 105 cells were transfected with indicated constructs by using P3 Primary Cell 4D-Nucleofector X kit (Lonza). After transfection ...
-
bioRxiv - Immunology 2020Quote: ... All cells were confirmed to be free of mycoplasmas before injection into mice by the MycoAlert detection kit (Lonza). Tumor growth was monitored using an electronic caliper and volumes were determined using the following formula ...
-
bioRxiv - Genomics 2019Quote: The input library plasmids were electroporated into the K562 cells with Cell Line Nucleofector Kit V (Lonza, VCA-1003). For each electroporation ...
-
bioRxiv - Microbiology 2020Quote: ... Cell lines were authenticated by morphologic evaluation and were checked for mycoplasma contamination (MycoAlertTM PLUS Mycoplasma Detection Kit, Lonza).
-
bioRxiv - Genetics 2019Quote: ... Hela cells were electroporated with plasmids using Ingenio electroporation kit (SopaChem) and the Nucleofector™ II/2b device (Lonza). Cells were harvested 24h post-electroporation ...
-
bioRxiv - Developmental Biology 2020Quote: ... Cells were transfected using the P3 Primary Cell 4D-Nucleofector™ X Kit S (Lonza-BioResearch, Cat #: V4XP-3032) and Amaxa™ 4D-Nucleofector™ (Lonza-BioResearch) ...
-
bioRxiv - Cell Biology 2019Quote: ... The cells were then mixed with 100uL of SE Cell Line 4D-Nucleofector® X Kit (Lonza, Basel, Switzerland) and transfected with 65nM siRNA diluted in MilliQ sterile-filtered water using the 4D-Nucleofector (Lonza ...
-
bioRxiv - Immunology 2019Quote: ... Pre-activated B cells were transfected using the P4 Primary Cell 4D-Nucleofector X Kit L (Lonza, V4XP-4024) in combination with the program DI-100 ...
-
bioRxiv - Immunology 2019Quote: ... Endotoxin concentrations were measured in all protein samples using the Limulus Amebocyte Lysate Kit – QCL-1000 (Lonza, Basel, Switzerland). The rMIC1 ...
-
bioRxiv - Developmental Biology 2021Quote: ... pPBCAG-hph and a PiggyBac Transposase vector using the AMAXA Mouse Embryonic Stem Cell Nucleofector Kit (LONZA, VPH-1001). Transfected cells were selected with 200 μg/ml hygromycin B Gold (Ibian tech. ...
-
bioRxiv - Developmental Biology 2021Quote: ... 5×106 EL16.7 TST ESCs were nucleofected with the AMAXA Mouse Embryonic Stem Cell Nucleofector Kit (LONZA, VPH-1001) using program A-30 with 1.6 µg each of GFP and tdTomato circularised targeting vectors and 5 µg single gRNA vector PX459 (5’-TATACCTAATCATTATGCCG-3’ ...
-
bioRxiv - Immunology 2021Quote: ... The siRNA duplexes were used to transfect purified human naïve B cells using the Human B Cell NucleofectorTM Kit (VPA-1001, LONZA). Transfected B cells were then stimulated with CpG ODN 2395 plus IL-2 and IL-21 for 96 h before genomic DNA extraction for analysis of Sμ-σδand Sμ-Sγ1 DNA recombination ...