Labshake search
Citations for Lonza :
101 - 150 of 155 citations for D Fructose U 13C6 since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2024Quote: ... and nucleofected using program EO-115 on a 4-D Nucleofector X unit (Lonza).
-
bioRxiv - Cell Biology 2020Quote: ... U–2–OS-pEP15 cells (5) were maintained in 1 mg/ml glucose phenol-red-free DMEM (Lonza) supplemented with steroid-free FBS (Thermo Fisher Scientific) ...
-
bioRxiv - Microbiology 2022Quote: ... diluted in an equal volume of DMEM containing 20% FBS and 200 U/ml of penicillin/streptomycin (Lonza), and ∼1.5×104 hemolymph sporozoites were added per well ...
-
bioRxiv - Neuroscience 2023Quote: ... and plated on poly-D-lysine coated flasks with astrocyte growth media (Lonza, Basel, Switzerland), changing the media every 3 days ...
-
bioRxiv - Immunology 2023Quote: ... and primary T cells were electroporated using the P3 Primary Cell 4-D Kit (Lonza). For Cas9 and sgRNA delivery ...
-
bioRxiv - Bioengineering 2024Quote: ... and fibroblasts were nucleofected using a 4-D Nucleofector system and 96-well unit (Lonza). gRNAs were prepared by annealing crRNA and trcrRNA (IDT ...
-
bioRxiv - Microbiology 2021Quote: ... berghei ANKA using the parasite nucleofector II kit and the Nucleofector II device with the U-033 program (Lonza). Transfected parasites were injected intravenously into 5 - 7 weeks old female ddY mice ...
-
bioRxiv - Biochemistry 2021Quote: ... then the ventricles were dissected and dissociated by serial digestion at 37°C with 0.44 mg/ml (6800 U) Worthington Type II collagenase (supplied by Lonza) and 0.6 mg/ml pancreatin (Sigma-Aldrich ...
-
bioRxiv - Molecular Biology 2023Quote: ... supplemented with 10% tetracycline-free and heat inactivated fetal bovine serum (FBS) and 100 U/mL penicillin/streptomycin (Lonza). Cell lines were grown at 37 °C in a humidified atmosphere of 5% CO2 and were tested for absence of mycoplasma contamination.
-
bioRxiv - Immunology 2024Quote: ... 107 schizonts were resuspended 100ul in human T cell transfection buffer containing 5μg digested DNA for transfection by U-33 program (Lonza).
-
bioRxiv - Cell Biology 2020Quote: U-2 OS cells stably expressing spdCas9-GFP were nuclofected with Amaxa® Cell Line Nucleofector® Kit V (Lonza). Cells were detached with 0.05% trypsin/EDTA and spun down by centrifugation at 1000rpm for 5 min ...
-
bioRxiv - Microbiology 2021Quote: ... 50 μl or 100 μl of homogenate from groups was plated on both YPD agar supplemented with 250 U/ml ,250 μg/ml penicillin-streptomycin (Lonza), 30 μg/ml gentamicin sulfate (BioWhittaker ...
-
bioRxiv - Cancer Biology 2022Quote: ... Pmel-1 CD8+ T cells were activated by incubating with R10 media (RPMI containing 10 % FBS, 100 U/mL penicillin and 100 mg/mL streptomycin (all Lonza), 1x MEM NEAA ...
-
bioRxiv - Cell Biology 2022Quote: ... HEK-293T and U-2OS (ATCC, Manassas, Virginia) cells were grown in Dulbecco’s modified Eagle’s medium (DMEM; Lonza, Basel, Switzerland) supplemented with 10% fetal bovine serum (FBS ...
-
bioRxiv - Microbiology 2023Quote: ... amazonensis promastigotes using the Human T-Cell Nucleofector kit and the Amaxa Nucleofector electroporator (program U-033, Lonza, Basel, Switzerland), for integration into the 18S rRNA locus within the nuclear DNA ...
-
bioRxiv - Immunology 2024Quote: ... siRNAs were added to 2 µM and electroporation was performed using the program U-001 on the 3D-Nucleofector (Lonza). The siRNAs targeting Clever-1 ...
-
bioRxiv - Bioengineering 2024Quote: ... at a 1:1 Target:T cell ratio in a 96-well U-bottom plates and 250 µl X-VIVO™ 15 (Lonza) supplemented with 5% human AB serum (Gemini Bio ...
-
bioRxiv - Bioengineering 2024Quote: ... at a 1:1 Target:T cell ratio in 96-well U-bottom plates with 250 µl X-VIVO™ 15 (Lonza) supplemented with 5% human AB serum (Gemini Bio ...
-
bioRxiv - Neuroscience 2022Quote: ... GFP expression plasmid was inserted into CAP-exosomes using 4-D-Nucleofector (instruments and reagents from Lonza, Basel ...
-
bioRxiv - Cancer Biology 2023Quote: ... using the P3 Primary Cell 4D-Nucleofector X Kit for Amaxa 4-D device (Lonza, #V4XP-3032). 2×10E5 cells per condition were nucleofected in separated strip wells using program EO-100 ...
-
bioRxiv - Bioengineering 2024Quote: ... and seeded with human pulmonary artery endothelial cells in rectangular channel experiments (HPAEC, Lonza, Fig.1A-D), or human umbilical vein endothelial cells in round channel experiments (HUVEC ...
-
bioRxiv - Cell Biology 2024Quote: ... and it contains Dulbecco’s Modified Eagles Medium 4.5 g/L D-glucose (DMEM; Lonza, Walkersville, MD, USA) supplemented with 50 U/mL penicillin ...
-
bioRxiv - Developmental Biology 2024Quote: ... The nucleofection process was carried out using the DN100 program on the Amaxa 4-D Nucleofector (Lonza).
-
bioRxiv - Cell Biology 2021Quote: ... containing bone marrow mononuclear cells was washed in 5 ml basal medium (α – MEM containing 10% FBS and 100 U mL−1 penicillin and 100 μg mL−1 streptomycin; Lonza). All washing stages were at 400 x g for 5 minutes.
-
bioRxiv - Cell Biology 2020Quote: ... containing bone marrow mononuclear cells was washed in basal medium (α-MEM containing 10% FBS and 100 U mL-1 penicillin and 100 µg mL-1 streptomycin; Lonza). Cells were subsequently either sorted using MACS or incubated with SNAs.
-
bioRxiv - Systems Biology 2021Quote: ... complemented with 10% fetal bovine serum (Biosera, France) and Penicillin/Streptomycin (100 U/ml and 100 μg/ml, respectively - Lonza, Switzerland). Cells were seeded on poly-L-lysine pretreated (0.001% ...
-
bioRxiv - Cell Biology 2024Quote: ... and 95% humidity in Human IntestiCult™ Organoid Growth Medium Human (IntestiCult OGMh) supplemented with 100 U/mL penicillin/streptomycin (Pen-Strep) (Lonza). Medium was replenished every second day ...
-
bioRxiv - Cell Biology 2021Quote: ... at 0.1-1 μg/mL or as a control a GFP plasmid (PmaxGFP, Lonza, Cat. No. D-00059) using Lipofectamine 3000 (Invitrogen ...
-
bioRxiv - Bioengineering 2021Quote: ... and electroporated with 2-4pmol HDR template using a 4-D Nucleofector with pulse code CM-150 (Lonza). VLP/template mix was added to 15,000 cells in 50ul DMEM +10% FBS and 1x penicillin/streptomycin.
-
bioRxiv - Genomics 2020Quote: ... that were then electroporated using a Lonza 4-D Nucleofector with 96-well Shuttle™ add-on (Lonza). Sequences of sgRNA can be found in Supplementary Table 2 ...
-
bioRxiv - Molecular Biology 2020Quote: HEK293 cells were passaged in poly-D-Lysine treated plates and incubated overnight in OPTI-MEM medium (Lonza) at 37°C ...
-
bioRxiv - Cell Biology 2024Quote: ... STD-M (−) consisted of Dulbecco’s Modified Eagles Medium 4.5 g/L D-glucose (DMEM; Lonza, Walkersville, MD, USA) supplemented with 50 U/mL penicillin (Thermo Fisher Scientific ...
-
bioRxiv - Microbiology 2020Quote: ... using the AMAXA Nucleofector 4D system (U-033 setting) and the P3 primary cell 4D-nucleofector X kit with the 16-well nucleocuvette strip (Lonza, V4XP-3032). Clones were obtained by FACS using the FACS Aria II sorter at the Stanford Shared FACS Facility for the brightest red parasites and single cloning the TdTomato+ enriched population by limiting dilution into 96-well plates.
-
bioRxiv - Immunology 2020Quote: ... 1 × 106 BLaER1 cells were transfected with 2 μg plasmid DNA using the Human B Cell Nucleofector Kit and Nucleofector I device (program U-15; both Lonza, Basel, Schweiz). On day 2 post transfection ...
-
bioRxiv - Immunology 2024Quote: ... and added to the supplied cuvettes and subjected to electroporation using the U-14 program on Amaxa Nucleofector I device (Lonza, Basel, Switzerland). Following electroporation ...
-
bioRxiv - Genomics 2024Quote: Transfection– K562-based CRISPR cell lines were nucleofected with 500 ng sgRNA plasmid DNA using 4-D nucleofector X Unit with 16-well nucleocuvette strips according to the manufacturer’s instructions (Lonza). For Casilio-i perturbations ...
-
bioRxiv - Cell Biology 2020Quote: ... cell monolayers were washed twice in sterile D-PBS and cells were detached with Trypsin 0.5 g/L EDTA 0.2 g/L (Lonza, # BE17-161E) for 5 minutes ...
-
bioRxiv - Microbiology 2020Quote: ... 20 µL of cell suspension was then gently mixed with each crRNP and aliquoted into a 96-well electroporation cuvette for nucleofection with the 4-D Nucleofector X-Unit (Lonza) using pulse code EO-120 ...
-
bioRxiv - Microbiology 2021Quote: ... Tightly synchronized schizonts were transfected using the Amaxa 4-D electroporator and P3 Primary Cell 4D Nucleofector X Kit L (Lonza) according to the protocol described by Moon et al ...
-
bioRxiv - Cell Biology 2020Quote: ... HMVECs-D were cultured in endothelial basal medium-2 (EBM-2) supplemented with EGM™-2 MV BulletKits™ (Lonza). Cell from passage 3 to passage 6 were used ...
-
bioRxiv - Cell Biology 2022Quote: ... and 20 μg of the donor DNA using the Amaxa 4-D Nucleofactor X machine (Pulse code FP158) and P3 Primary Cell Kit (Lonza), according to protocols described by Moon et al ...
-
bioRxiv - Molecular Biology 2022Quote: ... D-PBS was gently aspirated from the T cell pellet and then resuspended in 15 μL of buffer P3 (Lonza). The cell suspension was then transferred to the RNP mix and thoroughly triturated ...
-
bioRxiv - Immunology 2024Quote: ... A volume of 20 μL of cells was then transferred to the Nucleocuvette stripwell and electroporated with program DN-100 on a 4-D Nucleofector X unit (Lonza). Immediately after nucleofection ...
-
bioRxiv - Systems Biology 2024Quote: ... 20 µL of cell suspension was then gently mixed with each crRNP and aliquoted into a 96-well electroporation cuvette for nucleofection with the 4-D Nucleofector X-Unit (Lonza) using pulse code EO-120 ...
-
bioRxiv - Neuroscience 2024Quote: ... along with 20 μg recombinant Cas9 (IDT) and 1 pmol of each bridging oligonucleotide using the P3 Primary Cell 4-D-Nucleofector kit (Lonza) using the CA-137 program34 ...
-
bioRxiv - Neuroscience 2024Quote: ... 500 pmol Cas12 crRNA (GGAAAAGTAAAAGATGTCTGAAT, IDT) and 20 μg recombinant Cas12 (IDT) using the P3 Primary Cell 4-D-Nucleofector kit (Lonza) and 4D-Nucleofector X unit (Lonza ...
-
Synchronous 3D patterning of diverse CNS progenitors generates motor neurons of broad axial identitybioRxiv - Neuroscience 2024Quote: ... For the generation the ISL1 reporter line cells were nucleofected with pTG-Cr-ISL1 and pTG-HR-ISL1-p2A-mNeonGreen plasmids using a 4-D nucleofector system (AMAXA) and the P3 Primary Cell 4D-Nucleofector Kit (Lonza) following manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2024Quote: PC-3 cells (1 × 106 cells) were transfected with 2 μg of mGFP-GPI cDNA using a 4-D nucleofector (LONZA) and cultured in two 150-mm dishes until reaching approximately 100% confluence (2 × 107 cells) ...
-
bioRxiv - Microbiology 2023Quote: ... and placed into a sterile 2 mm gap cuvette with the appropriate DNA and transfected using an Amaxa Nucleofector II (Lonza, Basel, Switzerland; U-33 program). Parasites were immediately transferred to LIT medium for 24 hours before adding 10 μg/mL puromycin (Invivogen ...
-
Malaria parasite HOPS/CORVET complexes are critical for endocytosis and invasion organelles functionbioRxiv - Cell Biology 2024Quote: ... mature schizonts were enriched using a 60% Percoll density gradient and electroporated in transfection buffer containing 50 μg of purified plasmid DNA using an Amaxa Nucleofector II (Lonza, AAD-1001N, program U-033)(Moon et al ...