Labshake search
Citations for Lonza :
101 - 150 of 216 citations for CKLF Like MARVEL Transmembrane Domain Containing 7 CMTM7 Antibody since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genomics 2020Quote: Ramos AID-/- cells were transfected with plasmids containing arRNAs (pENTR promoter) and pMax (GFP, Amaxa, Lonza) at ratio of 1:10 ...
-
bioRxiv - Immunology 2021Quote: ... NIH) in 100 µl IMDM/Glutamax/10% FBS containing 2× MycoZap Plus-PR (Lonza #VZA-2021), 100 ng/ml human IL-2 (GoldBio #1110-02-50) ...
-
bioRxiv - Cell Biology 2021Quote: ... Cells were then passaged to P1 with ‘culture media’ containing DMEM F12 media (Lonza, Slough, UK), 10% foetal bovine serum (Labtech ...
-
bioRxiv - Cell Biology 2022Quote: ... containing 4.5 g/L glucose and supplemented with L-glutamine with sodium pyruvate (Lonza, Basel, Switzerland), 10% fetal bovine serum (Thermo Fisher Scientific ...
-
bioRxiv - Bioengineering 2023Quote: ... according to manufacturer’s instructions in a 24-well plate containing X-VIVO 15 media (Lonza, 04418Q) supplemented with 5% FBS (Sigma-Aldrich) ...
-
bioRxiv - Cell Biology 2023Quote: ... Human SH-SY5Y dopaminergic neuroblastoma cells were cultured in Dulbecco’s modified Eagle’s medium:F-12 (DMEM:F-12; 1:1) containing high glucose (3.151 g/L) (Lonza), supplemented with 10% (v/v ...
-
bioRxiv - Immunology 2023Quote: ... NIH) in 100 µl IMDM/Glutamax/ 10% FBS containing 2× MycoZap Plus-PR (Lonza #VZA-2021), 100 ng/ml human IL-2 (GoldBio #1110-02-50) ...
-
bioRxiv - Molecular Biology 2024Quote: ... containing 10 µg of Cas9 or Cas9/guide plasmidic DNA and transferred to a cuvette (Lonza). Cells were nucleofected with the DT-130 program using the 4D-Nucleofector system with Core and X unit (Lonza) ...
-
Starvation resistant cavefish reveal conserved mechanisms of starvation-induced hepatic lipotoxicitybioRxiv - Cell Biology 2024Quote: ... and mounted in 1% Low-Melt Agarose containing 0.02% Tricaine MS-222 (50080; Lonza, Basel, Switzerland) and imaged on a glass-bottomed FluoroDish (FD3510-100 ...
-
bioRxiv - Immunology 2024Quote: ... NIH) in 100 µL IMDM GlutaMAX/ 10% FBS containing 2× MycoZap Plus-PR (Lonza #VZA-2021), 100 ng/mL human IL-2 (GoldBio #1110-02-50) ...
-
bioRxiv - Genetics 2021Quote: ... RNPs containing recombinant CRISPR/Cas9 and sgRNA were transfected to human cell lines using a Nucleofector (Lonza). Stable cell lines were generated by selection of hygrogmycin resistance ...
-
bioRxiv - Cell Biology 2021Quote: ... The cells were detached from tissue culture flasks using PBS containing 0.25% trypsin (Lonza, Gaithersburg, MD, USA). The isolated endMSCs were characterized by flow cytometry and differentiation assay ...
-
bioRxiv - Bioengineering 2022Quote: ... termed assay medium (EBM-2 medium containing hFGF, hydrocortisone, GA-1000, 2% FBS, all from Lonza Biosciences). Cells were allowed to settle for 2 hours ...
-
bioRxiv - Genetics 2019Quote: ... were cultured in growth medium consisting of: DMEM containing L-Glutamine and 4.5 g/L Glucose (Lonza), with the addition of 10 % Foetal Bovine Serum (FBS) ...
-
bioRxiv - Physiology 2020Quote: ... Skeletal muscle cells were cultured in growth medium containing Dulbecco’s modified eagles medium (DMEM, Lonza, Nottingham, UK) and Medium-199 with Earle’s BSS (1:5 ...
-
bioRxiv - Bioengineering 2021Quote: ... in EGM-2 MV Microvascular Endothelial Cell Growth Medium containing EBM-2 basal medium (Lonza cat. CC3156) and supplemented with penicillin (50 units/mL ...
-
bioRxiv - Molecular Biology 2022Quote: SH-SY5Y and HEK293T cells were grown in Dulbecco’s modified Eagle’s medium containing L-glutamine and 4.5 g/L glucose (DMEM; Lonza) and supplemented with 10% fetal calf serum (Gibco ...
-
bioRxiv - Genomics 2023Quote: ... into 96-well plates containing 5 μl modified freeze buffer (0.1% NP-40, 7.5. % DMSO, 42.5 % 2X Profreeze-CDM (Lonza) in PBS ...
-
bioRxiv - Pathology 2023Quote: ... The isolated adult CMs were finally re-suspended in plating medium containing Medium 199 (Lonza, BE12-117F), 1% penicillin/streptomycin (Lonza ...
-
bioRxiv - Cell Biology 2023Quote: ... pH 7.3) containing 10 μg DNA and transfected by electroporation using an AMAXA Nucleofector® Device (Lonza) with program “X-001 free choice” ...
-
bioRxiv - Immunology 2024Quote: ... T cells were cultured in T cell medium containing X-VIVO™ 15 media (Lonza, Basel, Switzerland), 10% human AB serum (Corning Inc. ...
-
bioRxiv - Neuroscience 2024Quote: ... Trypsin was inactivated by adding an equal volume of DMEM/F12 containing 20% FBS (Lonza, Bio Whittaker). Cerebral cortex was dissociated by trituration in DMEM/F12 containing 10% FBS and 20 µg/ml DNase I (Roche ...
-
bioRxiv - Developmental Biology 2020Quote: ... a 1:1 mix containing EGM2-Incomplete (EGM2 media without supplementation with EGF, FGF2 and VEGF-A; Lonza) and macrophage media (v/v ...
-
bioRxiv - Immunology 2019Quote: ... gRNA and Cas9 containing plasmids were introduced to prostate epithelial cells using the basic nucleofector kit (Amaxa, Lonza) following the manufacturer’s instructions for primary mammalian epithelial cells (program W001) ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... 5 µl OptiMEM were mixed with 0.75 µl Lipofectamine and then added to 25 µl OptiMEM containing 0.1 µg GFP pMAX plasmid (Lonza) and 1 µl P3000 reagent ...
-
bioRxiv - Immunology 2020Quote: ... Cells were then washed with PBS and incubated in flu media containing 1% SeaPlaque agarose (Lonza, Basel, Switzerland). After 48hr incubation ...
-
bioRxiv - Microbiology 2022Quote: ... diluted in an equal volume of DMEM containing 20% FBS and 200 U/ml of penicillin/streptomycin (Lonza), and ∼1.5×104 hemolymph sporozoites were added per well ...
-
bioRxiv - Physiology 2023Quote: ... USA) were cultured in 5% fetal bovine serum containing endothelial cell growth medium (EGM-2; Lonza, Basel, Switzerland). Media was supplemented with heparin ...
-
bioRxiv - Cell Biology 2023Quote: For immunoprecipitations performed on THP-1 cells were first transfected with 2 μg of empty vector pCDNA 3.1 or plasmid containing 3x FLAG_Vamp-3 using the Amaxa 4D nucleoporator system (Lonza) with the Amaxa SG Cell line kit and program FF-100 and following manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2023Quote: K562 cells containing deletions in ALAS2 or FECH were created using a multi-guide strategy via nucleofection (Lonza) of Cas9/RNP complexes (Gene Knockout Kit v2 ...
-
bioRxiv - Cell Biology 2024Quote: ... containing the appropriate guide RNA (gRNA) sequences (CGCTCAACTCGGCCATGCGC; GCAACAGATGGAAGGCCTCC) using the AmaxaTM nucleofectorTM kit V (Lonza #VCA-1003). Monoclonal lines were screened for puromycin sensitivity ...
-
bioRxiv - Cell Biology 2021Quote: ... dissected samples were pulled onto a coverslip containing an agarose pad made of 1% low-melt agarose (Lonza #50100) dissolved in Tyrode’s buffer ...
-
bioRxiv - Neuroscience 2022Quote: ... culture conditions and characterization: The isolated epidermis was placed in a petri dish containing HBSS buffer (Lonza, # CC-5022) for 10 minutes at room temperature ...
-
bioRxiv - Cell Biology 2022Quote: ... HLFs were seeded in four wells of a 24-well plate in antibiotic free medium containing 2 % (Lonza, PromoCell) or 10 % (DZL ...
-
bioRxiv - Developmental Biology 2023Quote: ... containing 10 μg of the plasmid DNA and transfected using the program DS-112 of the 4D-nucleofector (Lonza). NSCs were harvested 48 hours post-nucleofection ...
-
bioRxiv - Neuroscience 2023Quote: ... We then placed a 100 μL droplet of the ice-cold monomer solution containing 0.1% (wt/vol) ammonium persulfate onto a hydrophobic glass plate treated with GelSlick (Lonza). The coverslip bearing the flattened sample was then inverted onto the droplet to form a uniform layer of monomer solution ...
-
bioRxiv - Bioengineering 2023Quote: ... The cells were first thawed and seeded on a T150 flask containing bronchial epithelial growth medium (Lonza CC-3170) for 2D cell culture growth ...
-
bioRxiv - Immunology 2023Quote: ... one plate was prepared with 100 µl IMDM/Glutamax/ 10% FBS containing 2× MycoZap Plus-PR (Lonza #VZA-2021), 100 ng/ml human IL-2 (GoldBio #1110-02-50) ...
-
bioRxiv - Molecular Biology 2023Quote: ... The cell suspension was mixed with a mixture (66 μl per plug) containing 0.83% low-melting-point agarose (SeaPlaque GTG; Lonza), 170 mM sorbitol ...
-
bioRxiv - Cancer Biology 2023Quote: Invasion assays were performed using human bronchial epithelial cells grown on collagen discs containing primary human pulmonary fibroblasts (Lonza Bioscience ...
-
bioRxiv - Biochemistry 2023Quote: ... Cells were harvested with trypsin, pelleted (500 g, 5 min, 4°C) and resuspended in PBS (pH 7.4) containing EDTA (Lonza) and 10% fetal bovine serum ...
-
bioRxiv - Immunology 2023Quote: ... cells were grown in standard keratinocyte growth medium TM 2 (KGMTM-2) containing 0.15 mM CaCl2 (low Ca– KGM-2; Lonza) without gentamycin ...
-
bioRxiv - Neuroscience 2023Quote: ... containing ∼1000 neurons) was transferred to 9 mL of wash media (DMEM/F12 with penicillin/streptomycin [Lonza; Allendale, NJ]), then recovered by centrifugation (∼350 xG ...
-
bioRxiv - Cancer Biology 2024Quote: ... resuspended in 100 µL nucleofection buffer containing RNP and electroporated according to manufacturer’s instructions using the 4D-Nucleofector (Lonza). Control cells were electroporated with SpCas9 nuclease only.
-
bioRxiv - Molecular Biology 2024Quote: ... Cells were harvested with trypsin, pelleted (500 g, 5 min, 4°C) and resuspended in PBS (pH 7.4) containing EDTA (Lonza) and 10% fetal bovine serum ...
-
bioRxiv - Bioengineering 2024Quote: hMSC were plated at 15,000 cells/well in 24-well plates and grown overnight in a growth medium containing 10% FBS (Lonza). Once cells reached 80% confluency ...
-
bioRxiv - Bioengineering 2024Quote: hMSC were plated at 15,000 cells/well in 24-well plates and grown overnight in a growth medium containing 10% FBS (Lonza). When cells reach 80% confluency ...
-
bioRxiv - Developmental Biology 2024Quote: ... anesthetized by incubation in egg water containing 0.003 % Tricaine and embedded laterally in 1 % low melting agarose (Lonza 50081) containing 0.16 mg/mL Tricaine in glass-bottom dishes (MatTek ...
-
bioRxiv - Immunology 2022Quote: ... Cells were stained with surface antibodies in PBS (Lonza) + 2% FCS ...
-
bioRxiv - Immunology 2021Quote: ... antibodies in serum-free X-Vivo 20 medium (Lonza), in the absence (Th0 ...