Labshake search
Citations for Lonza :
101 - 150 of 1599 citations for 3 Acetyl 5 4 chlorophenyl 2 methylfuran since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2021Quote: ... HXGPRT amplicon (2-5 µg) into 1x106 RH TIR1-3FLAG tachyzoites in P3 buffer using a 4D-nucleofector (Lonza) with pulse code FI-158 ...
-
bioRxiv - Immunology 2022Quote: ... were coated overnight at 4°C with 25μL of SEC fractions 1 to 5 diluted 1:2 with PBS (Cat. No. LZBE17-512F, Lonza). Wells were washed with 0.05% Tween-20 (Cat ...
-
bioRxiv - Genomics 2020Quote: ... Human umbilical vein endothelial cells were isolated from umbilical cords of healthy donors after cesarean sections (HUVECS; n = 4; RWTH Aachen) (55) or obtained from Lonza (n = 3, Basel, Switzerland) (8) ...
-
bioRxiv - Molecular Biology 2021Quote: ... and Alt-R™ HDR donor oligo 5’ GTGTTTAGAAAAAAAAGAGTGTTTTTTTACCAGGGCCTTTGGCTCTTCCAGGAAGCAGATGTCCGAGTCGGAATATAATAACCCTTTCATACTCTTG 3’ (PS modification, antisense; IDT) using a 4D-nucleofector System X Unit (Lonza, Basel, Switzerland) and the P3 primary Cell 4D-Nucleofector® X kit (#V4XP-3024 ...
-
bioRxiv - Cancer Biology 2024Quote: ... 1×106 T cells were transfected with Cas9/RNPs complexes of CD38 targeting guide RNA 5’-AGUGUAUGGGAUGCUUUCAA -3’ (Synthego) using Lonza 4D-Nucleofector™ X Unit (Lonza, AAF-1003X). Transfection was carried out in P3 Primary Cell 4D-Nucleofector™ Solution (Lonza ...
-
bioRxiv - Biochemistry 2023Quote: ... Cells were regularly passaged 2-3 times a week and routinely tested for mycoplasma contamination using MycoAlert Plus mycoplasma Detection kit (Lonza, #LT07-710).
-
bioRxiv - Bioengineering 2024Quote: ... at a ratio of 3:1 bead/cell and 20 IU of IL-2 (Preprotech, 200-02) in X-Vivo media (Lonza, 02-053Q) supplemented with 5% human serum and Pen/Strep ...
-
bioRxiv - Cell Biology 2021Quote: ... and cells were isolated by centrifugation at 500 g for 5 min at 4°C followed by being treated with ACK Lysing Buffer (10-548E, Lonza Bioscience, Switzerland) to remove red blood cells ...
-
bioRxiv - Neuroscience 2023Quote: ... Cells were electroporated at 5 million cells/100 mL cells per cuvette using a Lonza 4-D nucleofector with pulsecode DP-148 (Lonza, VVPA-1002). Cells were co-cultured for 5 additional days with human astrocyte before transferring cells to homeostatic culture conditions (MGdM media ...
-
bioRxiv - Molecular Biology 2021Quote: ... Cells were electroporated with enhancer (IDT, #1075915, final concentration 4 μM) in a nucleofector device (Lonza, Nucleofector 2; program D-032). Cells were incubated for 24 h to allow them to recover and then detached and cloned by serial dilution ...
-
bioRxiv - Developmental Biology 2022Quote: Primary HDLECs were isolated from neonatal human foreskins as described previously (74) and cultured from passages 5 – 7 on fibronectin-coated plates with EGM-2 MV growth media (Lonza) supplemented with human VEGF-C (R&D) ...
-
bioRxiv - Immunology 2021Quote: Human telomerase-immortalized corneal epithelial (hTCEpi) cells (26) were maintained at 37°C/5% CO2 in regular keratinocyte growth medium KGM-2 (Lonza). Prior to treatment ...
-
bioRxiv - Immunology 2021Quote: ... CD3/CD28 beads were removed 48 hours after stimulation and 5 × 106 CTLs were electroporated with 2 μg plasmid using 4D-Nucleofector (Lonza). Medium was changed 6 hours after nucleofection and transfected cells were used 24-36 hours after electroporation ...
-
bioRxiv - Developmental Biology 2022Quote: ... Primary MEC were cultured in endothelial growth media (EGM) containing 5% FBS with growth factors (EBM-2; Lonza, Basel, Switzerland) at 37°C in 5% CO2 ...
-
bioRxiv - Cell Biology 2024Quote: ... cells (5×105/well in 6-well plates) were transfected with 2 μg of DNA by nucleofection using Amaxa device (Lonza) following manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2022Quote: ... Cells were maintained at 37°C in 5% CO2 in either EGM-2 MV complete media (CC-3125, Lonza, Walkersville, MD) or in M199 supplemented with 20% FBS (Atlanta Biologicals ...
-
bioRxiv - Cell Biology 2022Quote: ... and CD31+Rspo3+ cells were centrifuged at 500 g for 5 min and resuspended in 500 μl endothelial cell media: EGM-2 MV Bullet Kit (Lonza, cc-3202) supplemented with 50 ng/mL VEGF-C (R&D ...
-
bioRxiv - Cell Biology 2024Quote: ... Cells were grown at 37°C with 5%CO2 using EGM-2 medium supplemented with SingleQuots from Lonza (CC-3156 & CC-4176). Cells were passaged using 0.25% trypsin EDTA every 2–3 days ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... 52 years-old; non-CF donor #2: WT-AB0834, male, 71 years-old; non-CF donor #4: CC-2540S-20TL256517, Lonza, female, 48 years-old). After co-incubation with correctors for 24 h in medium (MucilAir™ medium ...
-
bioRxiv - Bioengineering 2021Quote: ... HUVECs (Lonza, Passage <4) were cultured in an endothelial growth medium (C-22111 ...
-
bioRxiv - Bioengineering 2023Quote: ... in 6-well tissue culture plates and were allowed to adhere for 5 hours before induction of serum starvation in EBM-2 (LONZA, Cat# CC-3156) for 16 hours prior to being administered media of interest ...
-
bioRxiv - Immunology 2021Quote: Commercially available human primary PTs from 6 donors (3 males and 3 females, Lonza Walkersville Inc) were expanded at passage 4 ...
-
bioRxiv - Microbiology 2022Quote: ... 2 ml of 2% SeaPlaque™ Agarose (Lonza) in DMEM containing 2% FBS and 1% penicillin/streptomycin (P/S ...
-
bioRxiv - Microbiology 2021Quote: ... 2◻ml of 2% Seaplaque agar (Lonza) in Dulbecco’s modified Eagle medium (DMEM ...
-
bioRxiv - Microbiology 2021Quote: ... 2◻ml of 2% Seaplaque agar (Lonza) in DMEM containing 2% FBS ...
-
bioRxiv - Biophysics 2021Quote: ... HUVECs (Lonza, expanded to passage 3) were transduced with GFP tagged VE-cadherin (65 ...
-
bioRxiv - Bioengineering 2020Quote: ... HUVECs were cultured in Endothelial Growth Medium 2 (EGM-2) and NHLFs were cultured in Fibroblast Growth Medium 2 (FGM-2) (Lonza, Walkersville, MD). All cells were cultured in incubators at 37 °C and 5% CO2 ...
-
bioRxiv - Bioengineering 2020Quote: ... For transfection 4 × 106 cells/mL cells were resuspended in ProCHO-4 Medium (Lonza) supplemented with 4 mM Ultraglutamine (Lonza) ...
-
bioRxiv - Bioengineering 2021Quote: ... were purchased from Lonza and cultured in EGM-2 and FGM-2 (Lonza) supplemented with EGM-MV and FGM-2 Bullet Kit ...
-
bioRxiv - Bioengineering 2022Quote: ... Endothelial Cell Growth Medium-2 (EGM-2, Lonza, Switzerland) was used as the medium ...
-
bioRxiv - Genomics 2022Quote: ... donors (passage 4-9; Lonza) were grown in complete Endopan-3 medium kit (PAN-Biotech ...
-
bioRxiv - Cell Biology 2023Quote: ... or 4-D nucleofector (LONZA) according to the manufacturer’s instructions.
-
bioRxiv - Bioengineering 2022Quote: ... and 3% FBS (all from Lonza Biosciences), termed astrocyte medium ...
-
bioRxiv - Bioengineering 2022Quote: Endothelial cords were cultured in EGM-2 (EBM-2 with the addition of EGM-2 BulletKit) (Lonza). For most experiments ...
-
Cardiac pericytes are necessary for coronary vasculature integrity and cardiomyocyte differentiationbioRxiv - Physiology 2022Quote: ... were cultured in endothelial basal medium-2 (EBM-2) supplemented with EGM™-2 BulletKits™ (Lonza). Cells at passage 3 were used.
-
bioRxiv - Physiology 2020Quote: ... were cultured in endothelial basal medium-2 (EBM-2) supplemented with EGM™-2 BulletKit™ (Lonza). Cell from passage 3 to passage 6 were used ...
-
bioRxiv - Bioengineering 2020Quote: ... and 40 % EGM-2 (EBM-2 Lonza CC-3156; Clonetics) formed the basic medium ...
-
bioRxiv - Bioengineering 2022Quote: ... were obtained from Lonza and cultured in Endothelial Growth Medium-2 (EGM-2, Lonza) or EGM-2 BulletKit (Lonza) ...
-
bioRxiv - Immunology 2021Quote: ... Cells were cultured in EBM-2/EGM-2 medium (Lonza) with 12% FBS ...
-
bioRxiv - Immunology 2020Quote: ... coated plates in Keratinocyte Growth Medium 2 (KGM-2, Lonza) at a density of 2 x 105 cells/cm2 and cultured at 37°C at 5% CO2 ...
-
bioRxiv - Cell Biology 2022Quote: ... They were cultured in EC specific medium with 2% FBS (EGMTM-2 EC Growth Medium-2 BulletKitTM, LONZA® or EC Growth Medium 2, PromoCell®) at 105 cell/well in a 6 well plate ...
-
bioRxiv - Bioengineering 2020Quote: ... supplemented with 4 mM Ultraglutamine (Lonza). 0.625 μg of plasmid DNAs per million cells followed by 2.5 μg polyethyleneimine per million cells (Polysciences ...
-
bioRxiv - Cell Biology 2020Quote: ... EBM-2 (Endothelial Cell Growth Basal Medium-2, Lonza, #CC-3156) was supplemented with EGM-2 SingleQuots Supplements (Lonza ...
-
bioRxiv - Bioengineering 2022Quote: ... were purchased from Lonza and cultured in endothelial growth medium 2 (EGM-2) medium (Lonza). HUVECs were cultured in T-75 flasks in a humidified cell culture incubator at 37 °C and 5 % CO2 with culture medium being changed every two days ...
-
bioRxiv - Bioengineering 2022Quote: ... were cultured in Endothelial Basal Medium-2 (EBM-2, Lonza, MD) and supplemented with an Endothelial Growth Media-2 (EGM-2 ...
-
bioRxiv - Cell Biology 2021Quote: ... were cultured in endothelial cell growth medium 2 (EGM-2, Lonza)) ...
-
bioRxiv - Microbiology 2022Quote: ... were supplemented with FGM-2 growth medium-2 BulletKit™ (Lonza). Plasmids constructs encoding codon-optimized cDNA for MCPyV LT ...
-
An endothelial SOX18-mevalonate pathway axis enables repurposing of statins for infantile hemangiomabioRxiv - Molecular Biology 2024Quote: ... which consists of Endothelial Growth Basal Medium-2 (EBM-2; Lonza), SingleQuots supplements (all except hydrocortisone and gentamicin-1000 ...
-
bioRxiv - Cell Biology 2024Quote: ... Dorsomorphin (2 µM; StemMACS) and A-83-01 (2 µM; Lonza)) ...
-
bioRxiv - Genetics 2023Quote: ... supplemented with Smooth muscle Medium-2 (SmGM-2, CC-4149, Lonza). Briefly ...