Labshake search
Citations for Lonza :
101 - 150 of 1651 citations for 3 5 Diacetoxy 2 acetoxymethyl 6 phenethyl tetrahydro pyran 4 yl ester since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genomics 2020Quote: ... S2 cells were seeded at 2×106 per 6cm plate in 4 mL S2 medium (Lonza). One hour after plating ...
-
bioRxiv - Bioengineering 2023Quote: ... 2×109 Freestyle CHO-S cells were resuspended in 500ml ProCHO 4 Protein-free Medium (Lonza, Cat#BEBP12-029 ...
-
bioRxiv - Bioengineering 2024Quote: ... were cultured for a maximum of 4 passages cultured in EGM™-2 (Lonza #CC-4176) in T-175 or T-75 culture flasks (Thermo ...
-
bioRxiv - Cancer Biology 2021Quote: ... Primary uveal melanoma cells were equally divided onto two wells of a fibronectin-covered 6-well tissue culture plate and grown in 5% CO2 in MDMF medium which consists of HAM’s F12 (Lonza, Walkersville MD, USA) supplemented with 1 mg/mL BSA (Sigma-Aldrich ...
-
bioRxiv - Cell Biology 2021Quote: ... siRNA directed against Dsg1 (Integrated DNA Technologies) with a targeting sequence 5′-CCATTAGAGAGTGGCAATAGGATGA-3′ using Amaxa Nucleofector System (Lonza) for electroporation of cells according to manufacturer’s instructions.
-
bioRxiv - Neuroscience 2024Quote: ... and 300μM single stranded oligodeoxynucleotides (ssODN: 5’gggtccagggtggctgtcactcat ccttttttctggctaccaaaggtgcagataattaaGaagaagctggatcttagcaacgtccagccaagtgtggctcaaaggataatatc aaacacgtcc 3’) and the P3 Primary Cell 4D reaction mix (Lonza). We screened a minimum of 96 clones for genetic editing ...
-
bioRxiv - Molecular Biology 2020Quote: ... at Day 3-4 of phase I culture were electroporated using P3 Primary Cell 4D NucleofectorTM X Kit (from Lonza) with program DZ100 (Bak et al. ...
-
bioRxiv - Immunology 2021Quote: ... 2.106 T cells were resuspended in 20 µl of nucleofection solution with 3 µl or 4 µl RNP and transferred to Nucleofection cuvette strips (4D-Nucleofector X kit S; Lonza). Murine T cells were electroporated using the DN110 program of 4D nucleofector (4D-Nucleofector Core Unit ...
-
bioRxiv - Cell Biology 2024Quote: ... Cells were passaged 1:10 every 3-4 days by trypsinisation and were regularly screened for mycoplasma contamination (Mycoalert, Lonza).
-
bioRxiv - Immunology 2022Quote: Cryopreserved PBMC (2-5 × 106/sample) were thawed in prewarmed RPMI-1640 with L-glutamine (Lonza) + 10% FCS ...
-
bioRxiv - Cell Biology 2021Quote: ... 2 and 5 were isolated from human nonparenchymal liver cells (NPCs) purchased from Lonza (cat# HUCNP) as described previously (Chen et al. ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... Sf9 cells (4 × 105 cells* ml) in 2 ml of Insect-Xpress medium (Lonza, Walkersville, MD, USA) were transfected with recombinant bacmids using Cellfectin reagent (Life Technologies) ...
-
bioRxiv - Cell Biology 2022Quote: ... ∼2-4 million cells were electroporated using the T020 method of the Nucleofector™ 2b device (Lonza). Immediately after electroporation ...
-
bioRxiv - Biochemistry 2023Quote: ... ∼2-4 million cells were electroporated using the T020 method of the Nucleofector™ 2b device (Lonza). Immediately after electroporation ...
-
bioRxiv - Molecular Biology 2024Quote: ... Cells were washed with 4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid (HEPES) buffered saline solution (CC-5024, Lonza) before renewing the medium or passaging the cells ...
-
bioRxiv - Microbiology 2022Quote: ... pre-coated cell culture 6-well plate with EBM-2 endothelial media supplemented with 10% FBS and a growth factor bullet kit (Lonza, Walkersville, USA) 3 mL/well ...
-
bioRxiv - Developmental Biology 2023Quote: iPSCs were transfected with sgRNA 3’ UCCCUUUCCUCAGGUCACAG 5’ (Synthego) via nucleofection using program CA137 on a 4D Nucleofactor X (Lonza) as per manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2021Quote: ... Human primary hepatic stellate cells from donors 3 and 4 were purchased as isolated hepatic stellate cells from Lonza (cat# HUCLS). Donor information is listed below.
-
bioRxiv - Developmental Biology 2021Quote: ... HESCs were transfected with a total of 4ug DNA in a ratio 2:3 (gRNAs:donor template) using the Amaxa P3 Primary Cell 4D-Nucleofector Kit (Lonza). Puromycin was added 3 days after electroporation at a concentration of 0.5ug/ml ...
-
bioRxiv - Cancer Biology 2024Quote: ... and (iv) the NDF-2 and NDF-3 cell lines (human neonatal dermal fibroblast cell lines, #CC-2509; Lonza Bioscience ...
-
bioRxiv - Molecular Biology 2024Quote: ... Cells were harvested with trypsin, pelleted (500 g, 5 min, 4°C) and resuspended in PBS (pH 7.4) containing EDTA (Lonza) and 10% fetal bovine serum ...
-
bioRxiv - Biochemistry 2023Quote: ... Cells were harvested with trypsin, pelleted (500 g, 5 min, 4°C) and resuspended in PBS (pH 7.4) containing EDTA (Lonza) and 10% fetal bovine serum ...
-
bioRxiv - Bioengineering 2024Quote: ... The hUVEC cells were cultured and expanded until passage 5 with EGM-2 media (CC-3156, Lonza) and SingleQuot supplements (CC-4176 ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... Sf9 cells (4 x 105 cells*ml) in 2 ml of Insect-Xpress medium (Lonza; Cat#BE12-730P10) were transfected with recombinant bacmids using Cellfectin II reagent (Gibco-Thermo Fisher Scientific™ ...
-
bioRxiv - Bioengineering 2021Quote: ... and electroporated with 2-4pmol HDR template using a 4-D Nucleofector with pulse code CM-150 (Lonza). VLP/template mix was added to 15,000 cells in 50ul DMEM +10% FBS and 1x penicillin/streptomycin.
-
bioRxiv - Molecular Biology 2023Quote: ... ∼2-4 million cells were electroporated using the T-020 method of the Nucleofector™ 2b device (Lonza). Immediately after electroporation ...
-
bioRxiv - Bioengineering 2023Quote: Cells were cultured at 37°C and 5% CO2 in cell-specific media: primary human umbilical vascular endothelial cells (HUVECs, Lonza; up to passage 6) in EGM-2 (Lonza ...
-
bioRxiv - Immunology 2020Quote: ... Transfection of primary T cells with Cas9 RNP complexes and TCRβα HDR templates was performed 3-4 days following activation using the 4D-Nucleofector and a 20 uL format P3 Primary Cell kit (Lonza, V4XP-3032). Briefly ...
-
bioRxiv - Cell Biology 2022Quote: ... All cell lines were tested to be negative for mycoplasma every 2–3 months using the MycoAlert Mycoplasma Detection Kit (Lonza).
-
bioRxiv - Genetics 2020Quote: ... hESCs were nucleofected with 2 μg of CRISPR and 3 μl ssODN (100 μm) using the P3 Primary Cell Kit L (Lonza). hESCs were then plated onto puromycin-resistant (DR4 ...
-
bioRxiv - Pathology 2024Quote: Primary human lung fibroblasts from either IPF patients (n=4) or donors with no history of lung fibrosis (n=5) were purchased from Lonza at P2 (Supplementary Table 6) ...
-
bioRxiv - Genetics 2020Quote: ... 20 µg ssODNs and 4 µg pSpCas9(BB)-2A-GFP construct using Human Stem Cell Nucleofector Kit 2 (Lonza). For the generation of UE-RASGEF1A-int1-KO and PIK3C2B-int10-KO hPSC lines ...
-
bioRxiv - Cell Biology 2020Quote: ... U–2–OS-pEP15 cells (5) were maintained in 1 mg/ml glucose phenol-red-free DMEM (Lonza) supplemented with steroid-free FBS (Thermo Fisher Scientific) ...
-
bioRxiv - Physiology 2023Quote: ... USA) were cultured in 5% fetal bovine serum containing endothelial cell growth medium (EGM-2; Lonza, Basel, Switzerland). Media was supplemented with heparin ...
-
bioRxiv - Immunology 2023Quote: ... different tumor cell lines were stained with carboxyfluorescein succinimidyl ester (CFSE) following the manufacture’s protocols and cultured in X-vivo (Lonza) supplemented with 5% FBS (Gbico ...
-
bioRxiv - Bioengineering 2022Quote: ... GM-3TM Lymphocyte Growth Medium-3 (LGM-3™) (Lonza), Opti-MEM Serum-Free medium (Thermofisher) ...
-
bioRxiv - Developmental Biology 2021Quote: ... and 5 µg of PX459 gRNA vector (5’-GACTCCAGTCTTTCTAGAAGA-3’) were nucleofected with the AMAXA Mouse Embryonic Stem Cell Nucleofector Kit (LONZA, VPH-100) using program A-30 in the XRep ...
-
bioRxiv - Cancer Biology 2022Quote: A small fragment (2-4 mm3) of tumor biopsies or surgically resected tumor was cultured in RPMI 1640 plus (Lonza) containing 10% FBS Hyclone (GE Healthcare) ...
-
bioRxiv - Neuroscience 2021Quote: ... the suspension was centrifuged (215g for 5min at 4°C) and the pellet was resuspended in BMEC-media that comprised of EBM-2 medium (Lonza) supplemented with the following ...
-
bioRxiv - Bioengineering 2024Quote: ... The mixture was transferred to a confocal plate and subsequently UV crosslinked at 15 mW/cm2 for 1 minute and cultured for 4 days in EGM-2 media (Lonza).
-
bioRxiv - Cell Biology 2024Quote: ... supplemented with 11 mM glucose and 25 mM HEPES (4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid) pH 7.4 (Lonza, Basel, Switzerland). The apical (AP ...
-
bioRxiv - Microbiology 2021Quote: ... HXGPRT amplicon (2-5 µg) into 1x106 RH TIR1-3FLAG tachyzoites in P3 buffer using a 4D-nucleofector (Lonza) with pulse code FI-158 ...
-
bioRxiv - Immunology 2022Quote: ... were coated overnight at 4°C with 25μL of SEC fractions 1 to 5 diluted 1:2 with PBS (Cat. No. LZBE17-512F, Lonza). Wells were washed with 0.05% Tween-20 (Cat ...
-
bioRxiv - Genomics 2020Quote: ... Human umbilical vein endothelial cells were isolated from umbilical cords of healthy donors after cesarean sections (HUVECS; n = 4; RWTH Aachen) (55) or obtained from Lonza (n = 3, Basel, Switzerland) (8) ...
-
bioRxiv - Molecular Biology 2021Quote: ... and Alt-R™ HDR donor oligo 5’ GTGTTTAGAAAAAAAAGAGTGTTTTTTTACCAGGGCCTTTGGCTCTTCCAGGAAGCAGATGTCCGAGTCGGAATATAATAACCCTTTCATACTCTTG 3’ (PS modification, antisense; IDT) using a 4D-nucleofector System X Unit (Lonza, Basel, Switzerland) and the P3 primary Cell 4D-Nucleofector® X kit (#V4XP-3024 ...
-
bioRxiv - Cancer Biology 2024Quote: ... 1×106 T cells were transfected with Cas9/RNPs complexes of CD38 targeting guide RNA 5’-AGUGUAUGGGAUGCUUUCAA -3’ (Synthego) using Lonza 4D-Nucleofector™ X Unit (Lonza, AAF-1003X). Transfection was carried out in P3 Primary Cell 4D-Nucleofector™ Solution (Lonza ...
-
bioRxiv - Biochemistry 2023Quote: ... Cells were regularly passaged 2-3 times a week and routinely tested for mycoplasma contamination using MycoAlert Plus mycoplasma Detection kit (Lonza, #LT07-710).
-
bioRxiv - Bioengineering 2024Quote: ... at a ratio of 3:1 bead/cell and 20 IU of IL-2 (Preprotech, 200-02) in X-Vivo media (Lonza, 02-053Q) supplemented with 5% human serum and Pen/Strep ...
-
bioRxiv - Microbiology 2023Quote: ... 6 mmol/L l-glutamine (Lonza®), and a mixture of penicillin/streptomycin (100U/100 μg/mL ...
-
bioRxiv - Cell Biology 2021Quote: ... and cells were isolated by centrifugation at 500 g for 5 min at 4°C followed by being treated with ACK Lysing Buffer (10-548E, Lonza Bioscience, Switzerland) to remove red blood cells ...