Labshake search
Citations for Lonza :
1351 - 1400 of 1684 citations for 2 Amino 6 chloro 9 3 5 di O p toluoyl beta D 2 deoxyribofurnanosyl purine since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Physiology 2024Quote: The gRNA plasmid (1µg) and donor template plasmid (3µg) were introduced into 3T3-L1 cells (1X 10 6 cell) by electroporation (LONZA, Basel, Switzerland). After 48h of electroporation ...
-
bioRxiv - Cell Biology 2020Quote: ... cell monolayers were washed twice in sterile D-PBS and cells were detached with Trypsin 0.5 g/L EDTA 0.2 g/L (Lonza, # BE17-161E) for 5 minutes ...
-
bioRxiv - Microbiology 2020Quote: ... 20 µL of cell suspension was then gently mixed with each crRNP and aliquoted into a 96-well electroporation cuvette for nucleofection with the 4-D Nucleofector X-Unit (Lonza) using pulse code EO-120 ...
-
bioRxiv - Microbiology 2021Quote: ... Tightly synchronized schizonts were transfected using the Amaxa 4-D electroporator and P3 Primary Cell 4D Nucleofector X Kit L (Lonza) according to the protocol described by Moon et al ...
-
bioRxiv - Cell Biology 2022Quote: ... and 20 μg of the donor DNA using the Amaxa 4-D Nucleofactor X machine (Pulse code FP158) and P3 Primary Cell Kit (Lonza), according to protocols described by Moon et al ...
-
bioRxiv - Molecular Biology 2022Quote: ... D-PBS was gently aspirated from the T cell pellet and then resuspended in 15 μL of buffer P3 (Lonza). The cell suspension was then transferred to the RNP mix and thoroughly triturated ...
-
bioRxiv - Neuroscience 2024Quote: ... along with 20 μg recombinant Cas9 (IDT) and 1 pmol of each bridging oligonucleotide using the P3 Primary Cell 4-D-Nucleofector kit (Lonza) using the CA-137 program34 ...
-
bioRxiv - Neuroscience 2024Quote: ... 500 pmol Cas12 crRNA (GGAAAAGTAAAAGATGTCTGAAT, IDT) and 20 μg recombinant Cas12 (IDT) using the P3 Primary Cell 4-D-Nucleofector kit (Lonza) and 4D-Nucleofector X unit (Lonza ...
-
bioRxiv - Systems Biology 2024Quote: ... 20 µL of cell suspension was then gently mixed with each crRNP and aliquoted into a 96-well electroporation cuvette for nucleofection with the 4-D Nucleofector X-Unit (Lonza) using pulse code EO-120 ...
-
bioRxiv - Immunology 2024Quote: ... A volume of 20 μL of cells was then transferred to the Nucleocuvette stripwell and electroporated with program DN-100 on a 4-D Nucleofector X unit (Lonza). Immediately after nucleofection ...
-
Synchronous 3D patterning of diverse CNS progenitors generates motor neurons of broad axial identitybioRxiv - Neuroscience 2024Quote: ... For the generation the ISL1 reporter line cells were nucleofected with pTG-Cr-ISL1 and pTG-HR-ISL1-p2A-mNeonGreen plasmids using a 4-D nucleofector system (AMAXA) and the P3 Primary Cell 4D-Nucleofector Kit (Lonza) following manufacturer’s instructions ...
-
bioRxiv - Immunology 2022Quote: ... and resuspended in 5 mL of X-VIVOTM 15 (Lonza, BE02-060F) + 10% FBS (PEAK Serum ...
-
bioRxiv - Cancer Biology 2020Quote: ... through digestion of mammary glands in 5 mL of digestion media (Lonza/Amaxa DMEM/F12 1:1 Mixture with HEPES ...
-
bioRxiv - Cell Biology 2020Quote: ... After 5-7 days of expansion with BEGM media (Lonza #CC-3170), air-liquid interface (ALI ...
-
bioRxiv - Immunology 2022Quote: ... Co-cultures were done in IMDM supplemented with 5% HI-HS (Lonza) and gentamycin (86 μg/mL ...
-
bioRxiv - Bioengineering 2024Quote: ... human liver endothelial cells (LECs) (Lonza HLECP1; 4-5×106 cells/ml) were first loaded in the basal channel followed by seeding of human Huh7 hepatocytes (Sekisui JCRB0403-P ...
-
bioRxiv - Genetics 2021Quote: ... The short pvT1 amplicons were size-separated by electrophoresis in a 3% NuSieve (Lonza, Basel, Switzerland) agarose gel ...
-
bioRxiv - Developmental Biology 2020Quote: ... The cell suspensions were mixed with ultra low melting agarose solution (3% SeaPrep®, LONZA, #50302) in a volume ratio of 1:1 and were loaded onto the two aqueous phase inlets of the FFD ...
-
bioRxiv - Immunology 2022Quote: ... The isolated splenocytes were incubated for 3 mins in red blood cell lysis with ACK (Lonza) followed by washing with media ...
-
bioRxiv - Immunology 2020Quote: ... Antibodies which contained endotoxin levels above 3 EU/ml (Kinetic-QCL Kinetic Chromogenic LAL Assay, Lonza) were depleted of endotoxin with the ToxinEraser Endotoxin Removal kit (GenScript ...
-
bioRxiv - Bioengineering 2024Quote: Bone marrow organoids were fabricated by seeding 3 × 103 mesenchymal stem cells (hMSC, Lonza, PT-2501) and 6 × 103 human bone marrow CD34+ cells (STEMCELL Technologies ...
-
bioRxiv - Biochemistry 2023Quote: ... Virus was concentrated using ultracentrifugation (95000 g for 3 hr) and suspended using OPTI-MEM (Lonza). Viral transfections assays were performed by plating target 293T (ACE2+ve ...
-
bioRxiv - Cancer Biology 2023Quote: ... The absence of Mycoplasma contamination was verified every 3 weeks with the MycoAlert detection kit (Lonza). Previously described patient-derived short-term cultures (<10) ...
-
bioRxiv - Molecular Biology 2023Quote: ... Dinucleosome-sized DNA fragments were purified and excised from a 3% NuSieve GTG agarose gel (Lonza) using the Zymoclean Gel DNA Recovery Kit (Zymo Research) ...
-
bioRxiv - Immunology 2024Quote: ... The bEnd.3 cells were cultured in DMEM supplemented with L-glutamine (BE17-605 F; Lonza), Na-pyruvate (S-8636 ...
-
bioRxiv - Developmental Biology 2021Quote: Human isogenic ESCs containing different lengths of CAG repeats in the HTT Exon1 locus (HD-RUES2 6) were nucleofected using the Cell Line Nucelofector II (Kit L from Lonza, Walkersville, MD) by applying the B-016 program ...
-
bioRxiv - Cell Biology 2020Quote: ... 1×106 cells (grown in 6-well dishes) were subjected to nucleofection with Amaxa® Cell Line Nucleofector® kit V (VCA-1003, Lonza), following the manufacturer’s protocol ...
-
bioRxiv - Cancer Biology 2021Quote: ... Collected cells were counted at a density of 100,000 per well and seeded on matrigel pre-coated 6-well plates supplied with KBM-Gold keratinocyte growth medium (Lonza, Cat# 00192060) at 37°C in a humidified chamber with 5% carbon dioxide ...
-
bioRxiv - Cell Biology 2023Quote: ... RPE1 cell pellets containing 1×10^6 cells were resuspended in Nucleofection Solution for Primary Mammalian Epithelial Cells (Lonza cat# VPI-1005) in the presence of nucleofection enhancer (cat# 1075915 ...
-
bioRxiv - Neuroscience 2023Quote: ... Nucleofection was performed using the 4-D nucleofector system (AMAXA) and the P3 Primary Cell 4D-Nucleofector Kit (Lonza, V4XP-3024) following manufactures’ instructions (program CB-150) ...
-
bioRxiv - Biochemistry 2024Quote: ... and 50 mM D-mannitol] modified from a previous report,86 and electroporation was performed by a Nucleofector 2b device (Lonza Bioscience). Cells were transfected with siRNAs twice with a 48-h interval ...
-
bioRxiv - Bioengineering 2022Quote: ... was dissolved for at least 3 hrs at 37 °C in Dulbecco’s Phosphate-Buffered Saline (DPBS, Lonza) at twice the final concentration ...
-
bioRxiv - Immunology 2022Quote: Calu-3 cell line was obtained from ATCC and maintained in Eagle’s Minimum Essential Medium(EMEM; Lonza) supplemented with 10% fetal bovine serum (FBS) ...
-
bioRxiv - Immunology 2022Quote: Calu-3 lung carcinoma cells (HTB-55; ATCC) were cultured in Eagle’s minimum essential medium (EMEM, Lonza), supplemented with 9% fetal calf serum (FCS ...
-
bioRxiv - Cell Biology 2024Quote: ... and subsequently combined with 3 µl RNPs before being transferred to a 96-well electroporation plate (Lonza). Electroporation was performed using the pulse code EH115 on a 4D-Nucleofector 96-well Unit (Lonza ...
-
bioRxiv - Cell Biology 2022Quote: ... and 5×106 cells were resuspended in 100μL P3 solution containing Supplement1 (Lonza) with 5μg plasmid DNA (containing gRNA and Cas9-2A-GFP) ...
-
bioRxiv - Cell Biology 2022Quote: ... were maintained with EGM2 MV supplemented with 5% FBS (Lonza Group, Basel, Switzerland).
-
bioRxiv - Physiology 2020Quote: ... at a density of 5×105 cells/cm2 in BEGM media (Lonza Inc) and subsequently in ALI media as described previously (43) ...
-
bioRxiv - Immunology 2022Quote: ... the cells were resuspended in RPMI 1640 media (Lonza, supplemented with 5% HEPES) and counted ...
-
bioRxiv - Cancer Biology 2023Quote: ... the cell pellet was resuspended in 1-5 ml ACK lysis buffer (Lonza), according to the pellet size ...
-
bioRxiv - Cancer Biology 2023Quote: ... in a humidified 5% CO2 atmosphere in RPMI (Lonza 12-115F, Basel, Switzerland) supplemented with 10% fetal calf serum (FCS ...
-
bioRxiv - Plant Biology 2023Quote: ... pH=5) and an equal volume of autoclaved 1.2% NuSieveTM GTGTM agarose (Lonza) to a final agarose concentration of 0.6% ...
-
bioRxiv - Neuroscience 2023Quote: ... The RNP and HDR donor was delivered to MIN-6 cells by electroporation using the Lonza 4D-Nucleofector (Lonza Group AG, Basel, Switzerland), using the 96-well SE reagent kit and program CM-150 ...
-
bioRxiv - Bioengineering 2024Quote: ... RNP’s and DNA were electroporated (EP) into T-cells in 16 well EP cuvettes on a 4-D Nucleofector X unit (Cat # V4XP-3032, Lonza, Walkersville, VA) using pulse code EH-115 ...
-
bioRxiv - Bioengineering 2021Quote: ... All cell lines were tested for mycoplasma every 3 months using MycoAlert Mycoplasma Detection Kit (Lonza, Basel, Switzerland). All cells used were <20 passages from thaw.
-
bioRxiv - Immunology 2021Quote: ... and suspended at a concentration of 3 × 106cells/mL in RPMI-1640 (BioWhittaker®, Lonza, Walkersville, MD, USA) containing 15% heat-inactivated horse serum ...
-
bioRxiv - Microbiology 2021Quote: ... The human lung epithelial cell line Calu-3 (ATCC HTB-55) was maintained in DMEM F-12 (Lonza) supplemented with 10% FBS ...
-
bioRxiv - Neuroscience 2022Quote: ... Electrophoresis of 10 µl of RT-PCR products was performed using 3% agarose (SeaKem LE Agarose by Lonza) with molecular ladder gel containing 0.5 µg/ml ethidium bromide in x0.5 tris-acetate-ethylenediaminetetraacetic acid (TAE ...
-
bioRxiv - Cell Biology 2023Quote: Bone marrow derived DCs at day 7 (3×106) were transfected with 100μl of the Amaxa solution (Lonza) containing siRNA (control or target-specific ...
-
bioRxiv - Immunology 2023Quote: ... beads were removed on day 3 followed by electroporation using the Human T Cell Nucleofector™ Kit (Lonza) and the Amaxa Nucleofactor® 2b (Lonza ...