Labshake search
Citations for Lonza :
1251 - 1300 of 1319 citations for 3RS 4 Dimethylamino 3 methyl 2 2 diphenylbutanenitrile Isodidiavalo since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Evolutionary Biology 2020Quote: ... and PX458-AAVS1 (3 µg) were electroporated into 1.3×106 H9 cells using the Human Stem Cell Nucleofector Kit 1 (Lonza, VPH-5012). Following electroporation the cells were seeded across 3-wells of a 6 well plate coated with Matrigel in StemFlex supplemented with RevitaCell supplement (Thermo Fisher ...
-
bioRxiv - Immunology 2020Quote: ... Slices were immediately placed in a 6-well plate containing 3 mL per well of “complete RPMI”: RPMI (Lonza, 16-167F) supplemented with 10 % FBS (VWR ...
-
bioRxiv - Molecular Biology 2024Quote: ... All cell lines were confirmed to be mycoplasma negative every 3 weeks (MycoAlert™ Mycoplasma Detection Kit, Lonza, Bend, OR, USA). Fifteen micrograms of total whole cell lysates (WCL ...
-
bioRxiv - Immunology 2024Quote: ... were transfected with 0.1 nmol of siRNA oligonucleotides (listed in Extended Data Table 3) using a Human Monocyte Nucleofactor Kit (Lonza, VVPA-1007) and the AMAXA Nucleofector System (Lonza ...
-
bioRxiv - Bioengineering 2024Quote: ... Cells were cultured at passage 3 and seeded in triplicate in hMSC Growth Medium (MSCGM™ Mesenchymal Stem Cell Growth Medium, Lonza) with 10% FBS ...
-
bioRxiv - Genetics 2023Quote: ... The RNP complex together with 7 µg of donor DNA was nucleofected into 3 × 107 ISE6 cells using EN150 and buffer SF via the 4D-Nucleofector system (Lonza Bioscience) (Figure S1) ...
-
bioRxiv - Microbiology 2021Quote: ... Cells were tested for Mycoplasma contamination every 4 - 6 weeks and before each experiment (Mycoalert Mycoplasma Detection kit, Lonza).
-
bioRxiv - Immunology 2022Quote: ... The solution was centrifuged at 400G for 5 minutes at 4°C and the cell pellet was resuspended in 1mL of Hank’s Balanced Salt Solution (HBSS; Lonza) containing 1% BSA (Sigma Aldrich ...
-
Epigenetic Interaction between UTX and DNMT1 Regulates Diet-Induced Myogenic Remodeling in Brown FatbioRxiv - Physiology 2020Quote: SiRNAs or overexpressing plasmids were transfected into day 4 differentiated BAT1 brown adipocytes using Amaxa Nucleofector II Electroporator (Lonza) with an Amaxa cell line nucleofector kit L according to the manufacturer’s instructions (Lonza ...
-
bioRxiv - Immunology 2020Quote: ... Aliquots of 4 · 105 cells were transferred into individual wells of 16-well or 96-well nucleofection cuvettes (Lonza), combined with 20 µL pre-formed RNP or nucleofector solution (no RNP control) ...
-
bioRxiv - Neuroscience 2020Quote: ... 4-6 μg of plasmid was electroporated using the AMAXA Nucleofector device (Neurons Rat DRG, G-013 program; Lonza) before plating and maintained for 48 h.
-
bioRxiv - Molecular Biology 2024Quote: ... Cells were harvested with trypsin, pelleted (500 g, 5 min, 4°C) and resuspended in PBS (pH 7.4) containing EDTA (Lonza) and 10% fetal bovine serum ...
-
bioRxiv - Biochemistry 2023Quote: ... Cells were harvested with trypsin, pelleted (500 g, 5 min, 4°C) and resuspended in PBS (pH 7.4) containing EDTA (Lonza) and 10% fetal bovine serum ...
-
bioRxiv - Immunology 2023Quote: ... 1e6 cells were then mixed with either Cas9 or base editor mRNA (4 - 4.5 µg) and nucleofected with program EO-115 using a 4D Nucleofector (Lonza). Immediately after nucleofection ...
-
bioRxiv - Cell Biology 2024Quote: ... Ligase 4 was transiently complemented into KO cell lines by transfecting 500,000 cells with 100 ng of pmaxGFP (Lonza) and 500 ng of expression plasmid (empty vector ...
-
bioRxiv - Genomics 2024Quote: Transfection– K562-based CRISPR cell lines were nucleofected with 500 ng sgRNA plasmid DNA using 4-D nucleofector X Unit with 16-well nucleocuvette strips according to the manufacturer’s instructions (Lonza). For Casilio-i perturbations ...
-
bioRxiv - Molecular Biology 2021Quote: ... and 199 (M199) medium (3: 1) supplemented with 10% fetal bovine serum (FBS),10 mM glutamine and penicillin-streptomycin (all from Lonza, Basel, Switzerland) and their purity was verified with the fibroblast marker TE-7 (Merck ...
-
bioRxiv - Developmental Biology 2021Quote: ... and 5 µg of PX459 gRNA vector (5’-GACTCCAGTCTTTCTAGAAGA-3’) were nucleofected with the AMAXA Mouse Embryonic Stem Cell Nucleofector Kit (LONZA, VPH-100) using program A-30 in the XRep ...
-
bioRxiv - Developmental Biology 2021Quote: ... 4 μg of the donor ssDNA and 3 μg of a puromycin resistance plasmid (pCAG-puroR) using the Mouse ES Cell Nucleofector™ Kit (Lonza, Switzerland) following the manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2022Quote: ... Cell lines are cultivated at 37°C with 5% CO2 and were tested every 3 months for mycoplasma contamination using Universal Mycoplasma detection kit (ATCC, 30-1012K) or MycoAlert Plus Mycoplasma Detection Ki (Lonza, LT07-701). Cell lines were used no more than 30 passages.
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... A high resistance Plastiape® RS00 inhaler (Plastiape S.p.A, Osnago, Italy) containing size #3 HPMC capsules (V-Caps® Plus, Lonza, Morristown, NJ) and 1-3 mg of powder was attached to a USP induction port by a molded silicon adapter ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... were seeded onto 96-well plates at a density of 3×104 cells per well in 100 μL cell culture media that consisted of DMEM (Lonza, Basel, Switzerland), 1% penicillin–streptomycin (Lonza ...
-
bioRxiv - Genomics 2024Quote: ... and electroporated with 6 μg of gRNA-Cas9 expression vector and 3 μg of SNRPN targeting vector using the P3 Primary Cell 4D-Nucleofector Kit (Lonza, V4XP-3032). Transfected cells were plated into a 10 cm dish coated with Matrigel (Corning ...
-
bioRxiv - Microbiology 2023Quote: ... Full-thickness samples were obtained by 12 mm punch and placed in 12-well plates containing 3 mL Dulbecco’s Modified Eagle Medium (DMEM) (Lonza, Walkersville, MD, USA) supplemented with 10% fetal bovine serum (FBS ...
-
bioRxiv - Neuroscience 2024Quote: ... A total of 3 × 106 cells were centrifuged and nucleofected using the P3 Primary Cell 4D-Nu-cleofector X Kit L (Lonza, V4XP-3024), a 4D-nucleofector core unit ...
-
bioRxiv - Bioengineering 2024Quote: ... 1,000,000 NIH/3T3 cells were centrifuged (200× g, 3 minutes) and resuspended in 100 µl of the SG Cell Line nucleofection Kit (Lonza, V4XC-3024). After the addition of 500 ng plasmid DNA encoding the hyperactive PiggyBac transposase and 1000 ng of the NTVE knock-in plasmid ...
-
bioRxiv - Developmental Biology 2020Quote: ... anti-sense RNA probe against Gdnf exons was transcribed and hybridized on thick sections derived from P4 kidneys embedded in 4% low melting agarose (NuSieve GTG, Lonza). BM purple was used for colorimetric reaction.
-
bioRxiv - Immunology 2021Quote: ... suspension CHO cells expressing wildtype human CTLA-4 were plated at 1 × 106 cells/well in DPBS (Lonza, Basel, Switzerland) containing 0.5% BSA (MilliporeSigma ...
-
bioRxiv - Cancer Biology 2021Quote: ... 4 μg of linearized plasmid containing wild-type or Ku70 3A cDNA was transfected using Amaxa nucleofector solution V (Lonza) and program T-020 ...
-
bioRxiv - Microbiology 2020Quote: ... The same number of cells (2 x 106 cells) were lysed in 100 µl of 1% CHAPS/PBS and analyzed on 4-20% SDS-PAGE gel (Lonza). The envelope proteins were detected by 2F5 (specific for gp41 ...
-
bioRxiv - Cell Biology 2022Quote: ... Expression of eGFP-Centrin1 was achieved by electroporating 4.106 B lymphoma cells with 4 μg of plasmid using the Amaxa Cell Line Nucleofector Kit R (T-016 program, Lonza). Cells were cultured in CLICK medium for 5 to 16 h before imaging.
-
bioRxiv - Biochemistry 2022Quote: ... and 18-36 μl ribonucleoprotein complexes were added along with 4 μM Alt-R Cas9 electroporation enhancer (IDT) to a nucleofection chamber (Lonza). Cells were electroporated using the nucleofector program EN-138 and gently resuspended in DMEM ...
-
bioRxiv - Biophysics 2022Quote: ... 4-6 µg of DNA was mixed with the resuspended cells and electroporated using the Amaxa cell nucleofector (Lonza Laboratories) program Q-001 ...
-
bioRxiv - Cell Biology 2021Quote: ... or mutant) plasmids (4µg) were introduced to 4×106 dissociated neurons using Amaxa rat nucleofector kit (Lonza Bioscience, VPG-1003). Amaxa-nucleofected neurons plated at 500,000 cells per 35mm poly-D-lysine-coated glass bottom dish (WillCo Wells ...
-
bioRxiv - Microbiology 2020Quote: ... 20 µL of cell suspension was then gently mixed with each crRNP and aliquoted into a 96-well electroporation cuvette for nucleofection with the 4-D Nucleofector X-Unit (Lonza) using pulse code EO-120 ...
-
bioRxiv - Cancer Biology 2020Quote: ... Cell line authenticity was confirmed by STR genotyping (July 2019) and mycoplasma testing was performed every 4-6 weeks (MycoAlert, Lonza).
-
bioRxiv - Cell Biology 2021Quote: ... was generated by the introduction of a plasmid carrying the EGFP gene under the control of the CAG promoter to EStTA5-4 cells using the Amaxa Mouse ES cells Nucleofector Kit (VPH-1001, Lonza).
-
bioRxiv - Microbiology 2021Quote: ... Tightly synchronized schizonts were transfected using the Amaxa 4-D electroporator and P3 Primary Cell 4D Nucleofector X Kit L (Lonza) according to the protocol described by Moon et al ...
-
bioRxiv - Immunology 2020Quote: ... Cells were mixed with 5 μl of the RNP mixture by gently pipetting and were transferred to pre-cooled (4 °C) 16 well Nucleocuvette Strips (Lonza). Primary human B cells were nucleofected using the EH100 program of Lonza’s protocol ...
-
bioRxiv - Cell Biology 2021Quote: ... Western blots were conducted by running equivalent amounts of protein on 4-20% Tris-Glycine SDS/polyacrylamide gradient gels (Lonza) after reduction with 2-mercaptoethanol and heating to 95°C for 5m ...
-
bioRxiv - Developmental Biology 2020Quote: ... 4 μg of plasmid DNA was introduced to 4×106 neurons using an AMAXA nucleofection kit (VPG-1001, VPG-1003; Lonza). AMAXA-nucleofected cells were plated in 35mm glass bottom imaging dishes ...
-
bioRxiv - Cell Biology 2022Quote: ... and 20 μg of the donor DNA using the Amaxa 4-D Nucleofactor X machine (Pulse code FP158) and P3 Primary Cell Kit (Lonza), according to protocols described by Moon et al ...
-
bioRxiv - Neuroscience 2024Quote: ... Four wells of EBs per line were seeded in a 4-layer cell discs coated with growth factor-reduced matrigel in X-VIVO15 medium (Lonza) supplied with GlutaMAX (Gibco) ...
-
bioRxiv - Molecular Biology 2023Quote: ... the paired RNPs were combined and nucleofected into 4×105 Raw 264-7 cells suspended in 10 ul of nucleofection buffer (Lonza) using the program DS-136 in a 4D Nucleofector X Unit (Lonza) ...
-
bioRxiv - Neuroscience 2024Quote: ... along with 20 μg recombinant Cas9 (IDT) and 1 pmol of each bridging oligonucleotide using the P3 Primary Cell 4-D-Nucleofector kit (Lonza) using the CA-137 program34 ...
-
bioRxiv - Neuroscience 2024Quote: ... 500 pmol Cas12 crRNA (GGAAAAGTAAAAGATGTCTGAAT, IDT) and 20 μg recombinant Cas12 (IDT) using the P3 Primary Cell 4-D-Nucleofector kit (Lonza) and 4D-Nucleofector X unit (Lonza ...
-
bioRxiv - Systems Biology 2024Quote: ... 20 µL of cell suspension was then gently mixed with each crRNP and aliquoted into a 96-well electroporation cuvette for nucleofection with the 4-D Nucleofector X-Unit (Lonza) using pulse code EO-120 ...
-
bioRxiv - Pathology 2024Quote: Primary human lung fibroblasts from either IPF patients (n=4) or donors with no history of lung fibrosis (n=5) were purchased from Lonza at P2 (Supplementary Table 6) ...
-
bioRxiv - Immunology 2024Quote: ... A volume of 20 μL of cells was then transferred to the Nucleocuvette stripwell and electroporated with program DN-100 on a 4-D Nucleofector X unit (Lonza). Immediately after nucleofection ...
-
Synchronous 3D patterning of diverse CNS progenitors generates motor neurons of broad axial identitybioRxiv - Neuroscience 2024Quote: ... For the generation the ISL1 reporter line cells were nucleofected with pTG-Cr-ISL1 and pTG-HR-ISL1-p2A-mNeonGreen plasmids using a 4-D nucleofector system (AMAXA) and the P3 Primary Cell 4D-Nucleofector Kit (Lonza) following manufacturer’s instructions ...