Labshake search
Citations for Lonza :
1151 - 1200 of 1883 citations for Parallel Artificial Membrane Permeability Assay PAMPA Kit since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2024Quote: ... siRNA transfections were performed using the 4D-Nucleofector and the SE cell line 4D-Nucleofector X kits (Lonza) according to the manufacturer’s instructions ...
-
bioRxiv - Synthetic Biology 2024Quote: ... and Jurkat cell lines tested negative for mycoplasma with the MycoAlert Mycoplasma Detection Kit (Lonza Cat #LT07-318).
-
bioRxiv - Neuroscience 2024Quote: ... we used the 4D-Nucleofector system and Amaxa P3 primary Cell 4D-Nucleofector X Kit S from Lonza. The electroporation buffer used was P3 primary cell Nucleofector Solution with Supplement 1 (Lonza) ...
-
bioRxiv - Immunology 2024Quote: ... 1 - 2.5 × 106 Jurkat T cells were resuspended in EP buffer from the Nucleofector® Kit V (Lonza). Cells were combined with 1.5 μg of donor plasmid in a reaction volume of 100 μL and electroporated on the Amaxa® Nucleofector® II using pulse code X-005.
-
bioRxiv - Immunology 2024Quote: ... 16.4µl P3 and 3.6µl Supplement Reaction solutions from P3 Primary Cell 4D X Kit S (Lonza V4XP-3032) were added ...
-
bioRxiv - Cell Biology 2023Quote: ... dermal fibroblasts were expanded and verified mycoplasm negative via MycoAlert™ PLUS Mycoplasma Detection Kit (Lonza, 75860-362) infected with Sendai virus containing Yamanaka factors from the CytoTune™-iPS 2.0 Sendai Reprogramming Kit (ThermoFisher ...
-
Hallmark molecular and pathological features of POLG disease are recapitulated in cerebral organoidsbioRxiv - Cell Biology 2023Quote: ... Regular monitoring for mycoplasma contamination was performed using the Myco Alert™ Mycoplasma Detection Kit (Lonza, #LT07-218) to ensure the integrity of the cell lines.
-
bioRxiv - Cell Biology 2023Quote: ... All human cell lines were tested for Mycoplasma contamination using a MycoAlert Mycoplasma Detection Kit (Lonza, Basel, Switzerland).
-
A spatially resolved EGFR signaling model predicts the length scale of GAB1-SHP2 complex persistencebioRxiv - Systems Biology 2023Quote: ... Cells were confirmed to be mycoplasma-negative using the MycoAlert Mycoplasma Detection Kit (LT07-318; Lonza, Basel, Switzerland).
-
bioRxiv - Synthetic Biology 2023Quote: ... 1 × 106 HEK293T cells were transfected using SF Cell Line 4D-NucleofectorTM X Kit S (Lonza, V4XC-2012) with 7 µg of 5’ modified donor ...
-
bioRxiv - Biochemistry 2023Quote: ... Cell lines were tested once a month for mycoplasma contamination using Mycoalert® Detection Kit (Lonza, Basel, Switzerland). MCF7 and MDA-468 cells were grown in RPMI 1640 medium (Thermo Fisher Scientific ...
-
Vps18 contributes to phagosome membrane integrity in Mycobacterium tuberculosis-infected macrophagesbioRxiv - Microbiology 2023Quote: ... and nucleofection was performed as per the manufacturer’s recommendations (Lonza, SG Cell Line 4D-Nucleofector X Kit S). Monoclonal isolation of the knockouts were performed by limiting dilution ...
-
bioRxiv - Immunology 2023Quote: ... 1×10e6 cells per guide were electroporated with the corresponding RNP complex using Lonza Electroporation Kit V (Lonza). After 48 h ...
-
bioRxiv - Immunology 2022Quote: ... All cell lines were confirmed to be free of mycoplasmas using the MycoAlert detection kit (Lonza, Basel, Switzerland). Cells were detached in PBS EDTA 5mM without enzymatic solution to avoid HVEM cleavage.
-
bioRxiv - Cancer Biology 2022Quote: ... All cells were negative for Mycoplasma upon regular testing with the MycoAlert Mycoplasma Detection Kit (Lonza; LT07-318). LARP1 knockout cell line generation was performed using Edit-R™ CRISPR-Cas9 Gene Engineering ...
-
bioRxiv - Cancer Biology 2022Quote: ... All cell lines were routinely tested for mycoplasma contamination using MycoAlert PLUS mycoplasma detection kit (Lonza, MD, USA) and molecularly characterised using an “in house” panel of cellular and molecular markers to check that cell lines have not been cross contaminated (every 3-6 month) ...
-
bioRxiv - Biochemistry 2022Quote: ... Cell lines were regularly tested and verified to be mycoplasma negative using MycoAlert PLUS Mycoplasma Detection Kit (Lonza).
-
bioRxiv - Cancer Biology 2022Quote: ... All cell lines were regularly tested for mycoplasma contamination using a biochemical test kit (#LT07-318, Lonza, Switzerland) and were free of mycoplasma contamination.
-
bioRxiv - Cell Biology 2022Quote: ... 25 μg mRNA was transfected into 2.5 × 106 freshly thawed fibroblasts using Cell Line Nucleofector Kit V (Lonza) and AMAXA program X-001 following the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2022Quote: ... Transient transfections of these dominant-negative Rab11 a and siRab11 a into mouse MΦs (RAW 264.7 cell line) were performed with Amaxa mouse macrophage nucleofector kit (VPA-1009, Lonza) and DharmaFECT 4 Transfection Reagent (T-2004-01 ...
-
bioRxiv - Cell Biology 2022Quote: ... All cell lines were routinely tested for mycoplasma contamination by using the MycoAlert PLUS Mycoplasma Detection Kit (Lonza).
-
bioRxiv - Neuroscience 2023Quote: ... CRISPR reagents were transfected into iPSCs using the P3 Primary Cell 4D Nucleofector™ X Kit S (Lonza), as previously described (Deneault et al. ...
-
bioRxiv - Molecular Biology 2023Quote: ... and resuspended carefully in 20ul 4D-Nucleofector™ Solution (SE Cell Line 4D-Nucleofector™ X Kit, Lonza). Thereafter ...
-
bioRxiv - Immunology 2024Quote: ... NU-DHL1 cells were transfected using the SG Cell Line 4D-Nucleofector™ X Kit V4XC-3024 (Lonza) with the DS-104 setting.
-
bioRxiv - Cell Biology 2024Quote: ... HeLa cells were electroporated using the Amaxa system with the nucleofection kit Cat No VCA-1003 from Lonza. Cells were FACS-sorted into 96-well plates to obtain single-cell derived colonies carrying the INDEL mutations ...
-
bioRxiv - Cancer Biology 2024Quote: ... Absence of Mycoplasma contamination was determined at every plating using the MycoAlert kit according to manufacturer’s instructions (Lonza). Cell lines were cultured in 5% CO2 in a humidified atmosphere in 37°C ...
-
bioRxiv - Immunology 2024Quote: ... The P14 cell/Cas9/RNP mixes were transferred to Nucleofection cuvette strips (4D-Nucleofector X kit S; Lonza). Cells were electroporated using a 4D nucleofector (4D-Nucleofector Core Unit ...
-
bioRxiv - Immunology 2024Quote: ... All cells were confirmed to be negative for mycoplasma contamination as assessed by MycoAlert Mycoplasma Detection Kit (Lonza).
-
bioRxiv - Immunology 2024Quote: ... 1×106 cells per guide were electroporated with the corresponding RNP complex using Lonza Electroporation Kit V (Lonza). After 48 h ...
-
bioRxiv - Bioengineering 2024Quote: ... in a strip format using SF Cell Line 4D-Nucleofector™ X Kit S (Lonza, Cat# V4XC-2032). Purified PEs and CODEs were complexed with either pegRNA or cpegRNA to form RNP at 50 pmol protein ...
-
bioRxiv - Biochemistry 2024Quote: ... 3×105 cells were electroporated using P3 Primary Cell Nucleofector® 4D Kit and Nucleofector 4D system (Lonza) with 400 ng donor DNA ...
-
bioRxiv - Cancer Biology 2024Quote: ... Possible mycoplasma contamination was routinely monitored across all cell lines using the MycoAlert detection Kit (Lonza; LT07-318).
-
bioRxiv - Molecular Biology 2024Quote: ... and were routinely determined to be negative for Mycoplasma infection using a MycoALert detection kit (Lonza #LT07-118).
-
bioRxiv - Cancer Biology 2024Quote: ... Lines were regularly tested for mycoplasma contamination using the MycoAlert PLUS Mycoplasma Detection Kit (Lonza BioSciences, LT07-710). All cells were cultured in a Heracell humidified incubator (Thermo Fisher Scientific ...
-
bioRxiv - Cancer Biology 2024Quote: ... following a previously established and published protocol 123 or use of the MycoAlert PLUS Mycoplasma Detection Kit (Lonza). Only mycoplasma-negative cells were used.
-
bioRxiv - Bioengineering 2024Quote: ... were co-transfected with 2 µg plasmid-expressing guide RNA using a stem cell nucleofector kit (Lonza, Amaxa). Multiple guide RNAs were used to generate a collection of isogenic mutant cell lines ...
-
bioRxiv - Bioengineering 2024Quote: The absence of mycoplasma contamination was regularly checked with the MycoAlert PLUS Mycoplasma Detection Kit (Lonza, Visp, Switzerland).
-
bioRxiv - Cancer Biology 2024Quote: ... The media is comprised of small airway basal media (SABM) with selected components from SAGM bullet kit (Lonza) including Insulin ...
-
bioRxiv - Cancer Biology 2024Quote: ... Mycoplasma infection of cell lines was regularly checked for by using Mycoalert® Detection Kit (Lonza, Basel, Switzerland). Cells grown in an incubator at 37⁰C and 5% CO2.
-
bioRxiv - Cancer Biology 2024Quote: ... All cell lines were routinely tested for mycoplasma contamination by using the MycoAlert PLUS Mycoplasma Detection Kit (Lonza). Cell viability was assessed using Trypan Blue Solution ...
-
bioRxiv - Cancer Biology 2024Quote: ... The cell culture was checked for mycoplasma contamination with the MycoAlert® Mycoplasma Detection Kit (LT07-118, Lonza) according to the manufacturer’s guidelines ...
-
bioRxiv - Genetics 2024Quote: PHA-L-stimulated PBMCs (2.0-2.5x10^7 cells per reaction) were nucleofected with the P3 Primary Cell 4D-Nucleofector Kit (Lonza). After application of program EO-115 ...
-
bioRxiv - Cell Biology 2024Quote: ... and electroporated with plasmids for gene activation using P3 Primary Cell 4D-Nucleofector X Kit (Lonza V4XP-3032). The reactions were performed using the “CB-150” program on the Lonza 4D-Nucleofector X Unit ...
-
bioRxiv - Cell Biology 2024Quote: ... Cas9–sgRNA–RNP electroporation was conducted with the Amaxa P3 Primary Cell 96-well 4D-Nucleofector Kit (Lonza). The safe harbor T cells were targeted using the AAVS1 sequence GGGCCACTAGGGACAGGAT ...
-
bioRxiv - Cell Biology 2020Quote: ... or a FOXO1-targeted siRNA (GAGCGUGCCCUACUUCAAGGA) using the Amaxa(tm) Basic Nucleofector(tm) Kit for Primary Mammalian Fibroblasts (Lonza), according to the manufacturer’s protocol ...
-
bioRxiv - Genetics 2021Quote: ... Two million WTC iPSC were nucleofected using an Amaxa nucleofector 2B and the Nucleofector Kit C (both from Lonza), 0.5 µg of each AAVS1 TALEN pair and 1 µg of the donor plasmid (see Figure S4) ...
-
bioRxiv - Microbiology 2021Quote: ... All the cells used in this study tested negative for mycoplasma contamination using MycoAlert™ Mycoplasma detection kit (Lonza).
-
bioRxiv - Molecular Biology 2021Quote: ... siRNA transfections were performed using the 4D-Nucleofector and the SE cell line 4D-Nucleofector X kit L (Lonza) according to the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2021Quote: ... Cellular ATP levels were detected 20 h after glutamate exposure using the ViaLight™ Plus-Kit (Lonza, Verviers, Belgium) following the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2021Quote: ... The cell density was counted and ∼2.5 × 105 cells were transfected with indicated constructs by using P3 Primary Cell 4D-Nucleofector X kit (Lonza). After transfection ...