Labshake search
Citations for Lonza :
1151 - 1200 of 2071 citations for 6 BROMO 3 4 BROMO 2 METHYL PHENYL ISOQUINOLIN 1 YLAMINE since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biophysics 2024Quote: ... Young adult worms were placed on a thin layer of 2% agarose (Lonza, SeaKem LE agarose) prepared on a 24 × 55-mm coverslip (Matsunami Glass ...
-
bioRxiv - Neuroscience 2019Quote: ... 1% NEAA (Lonza), 1% N2 supplement (Thermo Scientific) ...
-
bioRxiv - Cancer Biology 2020Quote: ... 1% Ultraglutamine (Lonza)) in each well ...
-
bioRxiv - Genetics 2022Quote: ... 1% glutamine (Lonza) and 1% penicillin-streptomycin (Sigma) ...
-
bioRxiv - Molecular Biology 2021Quote: ... and Alt-R™ HDR donor oligo 5’ GTGTTTAGAAAAAAAAGAGTGTTTTTTTACCAGGGCCTTTGGCTCTTCCAGGAAGCAGATGTCCGAGTCGGAATATAATAACCCTTTCATACTCTTG 3’ (PS modification, antisense; IDT) using a 4D-nucleofector System X Unit (Lonza, Basel, Switzerland) and the P3 primary Cell 4D-Nucleofector® X kit (#V4XP-3024 ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: Five milligrams of niclosamide inhalation powder was loaded into size #3 hydroxypropyl methylcellulose capsules (Vcaps® plus, Capsugel®, Lonza, Morristown, NJ, USA). The aerodynamic properties of the powder were evaluated using a Next Generation Impactor (NGI ...
-
bioRxiv - Cancer Biology 2024Quote: ... 1×106 T cells were transfected with Cas9/RNPs complexes of CD38 targeting guide RNA 5’-AGUGUAUGGGAUGCUUUCAA -3’ (Synthego) using Lonza 4D-Nucleofector™ X Unit (Lonza, AAF-1003X). Transfection was carried out in P3 Primary Cell 4D-Nucleofector™ Solution (Lonza ...
-
bioRxiv - Molecular Biology 2019Quote: ... ES cells were grown in 1:1 mixture of DMEM (Lonza BioWhittaker Cat ...
-
bioRxiv - Cell Biology 2021Quote: ... neutralized 1:1 with Trypsin Neutralising Solution (TNS, Lonza, #CC-5002), spun down and concentrated to 15*106 cells/mL in EGM-2 ...
-
bioRxiv - Microbiology 2021Quote: ... 1% penicillin/streptomycin and 1% sea-plaque agarose (Lonza, Walkersville, MD). After a 2-days incubation ...
-
bioRxiv - Microbiology 2022Quote: ... A 1:1 mixture of Bronchial Epithelial Cell Basal Medium (Lonza) with Dulbecco’s Modified Eagle Medium (DMEM ...
-
bioRxiv - Immunology 2024Quote: ... at a 1:1 ratio overnight in X Vivo-15 (Lonza) supplemented with 2% KnockOut serum replacement (ThermoFisher) ...
-
bioRxiv - Immunology 2021Quote: ... Buffy coat cells were washed three times in 2.5 mM EDTA-PBS at 4°C before dilution and maintenance in RPMI-1640 supplemented with 10% FCS (PAA, AT or Lonza, CH) 2 mM glutamine ...
-
bioRxiv - Neuroscience 2023Quote: ... Nucleofection was performed using the 4-D nucleofector system (AMAXA) and the P3 Primary Cell 4D-Nucleofector Kit (Lonza, V4XP-3024) following manufactures’ instructions (program CB-150) ...
-
bioRxiv - Genetics 2021Quote: Human embryonic microglia clone 3 (HMC3, ATCC® CRL3304™) cells were cultured in minimum essential medium (MEM) Eagle-EBSS with NEAA without L-Glutamine (Lonza, Cologne, Germany) supplemented with 10% fetal bovine serum (Sigma-Aldrich ...
-
bioRxiv - Synthetic Biology 2021Quote: ... This mixture was nucleofected with 2×106 stimulated human primary T cells using the 4D-Nucleofector (Lonza) with the program EO-115 ...
-
bioRxiv - Cell Biology 2019Quote: ... Mycoplasma testing was performed on a regular basis (every 2 weeks) using the Mycoalert Detection Kit (Lonza).
-
bioRxiv - Genomics 2021Quote: ... PBMCs were then treated with 2 ml of erythrocytes lysis buffer (Lonza Walkersville inc. #120-02-070) for 1 min ...
-
bioRxiv - Developmental Biology 2021Quote: ... Cells were cultured on laminin-coated tissue culture flasks in SKGM-2 medium (Lonza®, Valkersville, MD). Medium was replaced every 3 days ...
-
bioRxiv - Genetics 2020Quote: ... Parasites were subsequently resuspended in 100 μL nucleofector solution of the Basic Parasite Nucleofector Kit 2 (Lonza), combined with 50 μL plasmid solution containing 5-10 μg DNA ...
-
bioRxiv - Bioengineering 2021Quote: Human umbilical vein endothelial cells (ECs) were cultured in endothelial growth medium (EGM-2; Lonza, Basel, Switzerland) supplemented with 1% penicillin-streptomycin-fungizone (Gibco ...
-
bioRxiv - Microbiology 2021Quote: Each transfection reaction was prepared by adding 2 µl of “primed” cells resuspended in SG buffer (Lonza) to a mixture of ...
-
bioRxiv - Cell Biology 2022Quote: ... Transient transfections of plasmids were performed 2 days before experiments using the Amaxa nucleofector (Lonza VPD-1004). The cells were detached with trypsin/EDTA ...
-
bioRxiv - Neuroscience 2020Quote: ... in EBM-2 medium supplemented with EGM-2MV SingleQuots (Lonza, Cat No CC-3156 and CC-4147) in an incubator set to 37 °C ...
-
bioRxiv - Cancer Biology 2021Quote: ... the digested splenic cells were cultured in endothelial cell growth medium EGM-2 (Cat# CC-3162, Lonza) at a density of 2-5 × 104/mL in fibronectin-coated culture flasks for 24 hours ...
-
bioRxiv - Cell Biology 2019Quote: ... while HMVEC-Lung and HMVEC-Colon were grown in EGM-2-MV medium (Lonza, Walkersville, MD, USA). Cells were used within 8 passages for all experiments.
-
bioRxiv - Cancer Biology 2019Quote: Human umbilical endothelial vein cells (HUVEC) were serum-starved overnight in EGM-2 media (Lonza, CC-3162) containing 0.2% FBS ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... Human umbilical venous endothelial cells (HUVECs) and EGM-2 bullet kits were obtained from Lonza (Basel, Switzerland).
-
bioRxiv - Cell Biology 2020Quote: ... Primary human pulmonary arterial smooth muscle cells (PASMCs) were cultured in SmGM-2 cell culture media (Lonza), and experiments were performed at passages 3 to 9 ...
-
bioRxiv - Immunology 2021Quote: ... 2 × 106 cells were suspended in 100 µL buffer (P3 Primary Cell 4D-Nucleofector X Kit, Lonza), mixed with 4 µg DNA and transfected using the 4D-Nucleofector program DN-100 ...
-
bioRxiv - Bioengineering 2024Quote: ... The hUVEC cells were cultured and expanded until passage 5 with EGM-2 media (CC-3156, Lonza) and SingleQuot supplements (CC-4176 ...
-
bioRxiv - Cell Biology 2024Quote: ... HMVEC-L were cultured in EGMTM-2MV Microvascular Endothelial Cell Growth Medium-2 BulletKitTM (Lonza, CC-3202) at 37°C ...
-
bioRxiv - Cell Biology 2024Quote: ... Eye enucleations were completed under aseptic conditions and maintained in EBM-2 media (CC-3156, Lonza, USA). All connective tissue was removed from the external part of the eyes and then the cornea ...
-
bioRxiv - Cancer Biology 2023Quote: ... M0 cells were then serum starved for 2 hours in X-VIVO™ hematopoietic cell medium (Lonza, Basel ...
-
bioRxiv - Microbiology 2023Quote: Caco-2 cells (human intestinal epithelial cell line) were cultured in DMEM - Dulbecco’s Modified Eagle Medium (Lonza) supplemented with 10% FBS (Gibco) ...
-
bioRxiv - Bioengineering 2023Quote: Primary NHLF were purchased from Lonza and subcultured for up to six passages in manufacturer supplied growth medium (FGM-2 BulletKit, CC3132, Lonza). The microtissues populated with NHLF were grown for 2 d before the addition of M2 macrophages at a ratio of 4:1 (M2 ...
-
bioRxiv - Neuroscience 2023Quote: ... HUVECs were transfected with 2 μg of RNF213 WT or R4810K construct using electroporation (Lonza, Basel, Switzerland), following the manufacturer’s protocol.
-
bioRxiv - Cell Biology 2024Quote: ... HMVEC-L were cultured in EGMTM-2MV Microvascular Endothelial Cell Growth Medium-2 BulletKitTM (Lonza, CC-3202) at 37°C ...
-
bioRxiv - Bioengineering 2024Quote: ... cells were thawed and expanded in EGM-2 endothelial cell growth medium (Lonza, cat. no. CC-3124) for two passages (P-2 ...
-
bioRxiv - Molecular Biology 2024Quote: ... ∼2 million cells were electroporated using the T-020 method of the Nucleofector™ 2b device (Lonza). Immediately after electroporation ...
-
bioRxiv - Cell Biology 2022Quote: hTERT immortalized RPE-1 (RPE1) cell lines were grown in an 1:1 mix of DMEM and F-10 (Lonza) and Human Embryonic Kidney (HEK ...
-
bioRxiv - Evolutionary Biology 2019Quote: ... 100mM EDTA at pH 8.0 and 1 mg ml−1 lysozyme and mixed with the same volume of 1% SeaKem Gold Agarose (Lonza, USA) in TE buffer containing 10 mM Tris ...
-
bioRxiv - Synthetic Biology 2022Quote: 1 x 106 BHK-21 cells were electroporated with a total of 7.8 μg of mRNA (1:1:1 of pSinHelper, pSinCapsid and pTSin-EGFP/pTSin-SRF-NLS-VP64) using Amaxa 2B (Lonza) as per the manufacturer’s instructions for BHK-21 cells ...
-
bioRxiv - Physiology 2019Quote: ... 50 ng.mL−1 amphotericin B and 10 μg.ml−1 heparin (BulletKitTM, Lonza). Experiments were performed on cells from passage 2-5 ...
-
bioRxiv - Microbiology 2020Quote: ... 100 IU ml-1 penicillin-100 µg ml-1 streptomycin mixture (Lonza), 2 mM L-glutamine (Lonza) ...
-
bioRxiv - Microbiology 2020Quote: ... 100 IU ml-1 penicillin-100 µg ml-1 streptomycin mixture (Lonza), 200 mM L-glutamine (Lonza) ...
-
bioRxiv - Cancer Biology 2019Quote: ... Animals were sacrificed by cervical dislocation four days after electroporation and resected xenografts were fixed in 4% (w/v) paraformaldehyde (PFA) in phosphate buffered saline (PBS) (Lonza, Basel, Switzerland) at 4°C for approximately one week ...
-
bioRxiv - Cell Biology 2021Quote: ... and cells were isolated by centrifugation at 500 g for 5 min at 4°C followed by being treated with ACK Lysing Buffer (10-548E, Lonza Bioscience, Switzerland) to remove red blood cells ...
-
bioRxiv - Immunology 2020Quote: ... 106 cells per condition were nucleofected with 4 µg of DNA using the Amaxa Nucleofector II (Lonza, Kit R; program R-024). Nucleofected cells were allowed to recover for 24-48 hours before sorting for GFP positivity and lack of CD56 expression.
-
bioRxiv - Cancer Biology 2019Quote: ... 2×105 cells were co-transfected with 2ug of the Cas9/sgRNA vector PxHF1* and 4 ul of ssODN HDR template (20 uM) using a Lonza X-Unit Nucleofector with P3 buffer kit (Lonza #V4XP-3032). Four days following transfection ...