Labshake search
Citations for Lonza :
1151 - 1200 of 1454 citations for 6 AMINO 2 5 DINITROPYRIDINE since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2024Quote: ... Two million E14 ESCs were nucleofected with paired Kdm3b targeting and donor plasmids (5 µg each) using the Amaxa 4D-Nucleofector protocol (Lonza) and selected with blasticidin S hydrochloride (Research Products International ...
-
bioRxiv - Molecular Biology 2023Quote: ... complexes for each peak to be deleted were prepared individually by mixing 120 pmol of sgRNA with 20 pmol of Cas9 protein (QB3 MacroLab, University of California, Berkeley) in 5 ul of P3 primary cell nucleofection buffer (Lonza) and incubated at room temperature for 15 minutes ...
-
bioRxiv - Microbiology 2023Quote: BHK-21 cells (clone BSRT7/5) constitutively expressing the T7 RNA polymerase47 were grown in Dulbeco Modified Essential Medium (Lonza) supplemented with 10% fetal calf serum (FCS) ...
-
bioRxiv - Cell Biology 2023Quote: HEK293T cells were grown in fifteen 25 cm2 flasks at 37°C in 5% CO2 using Dulbecco’s Modified Eagle Medium (Lonza, USA) supplemented with 10% FBS (Gibco ...
-
bioRxiv - Developmental Biology 2023Quote: ... Cells were used at passages 3-5 for experiments and cultured at 37°C and 5% CO2 in complete EC basal medium containing growth factors EGM2-Bulletkit (Lonza) to ensure a stable environment for optimal cell growth ...
-
bioRxiv - Developmental Biology 2023Quote: iPSCs were transfected with sgRNA 3’ UCCCUUUCCUCAGGUCACAG 5’ (Synthego) via nucleofection using program CA137 on a 4D Nucleofactor X (Lonza) as per manufacturer’s instructions ...
-
bioRxiv - Immunology 2022Quote: ... Cryopreserved PBMC (5 x 106/sample) were thawed in prewarmed RPMI-1640 media supplemented with L-glutamine (Lonza, Basel, Switzerland) + 10% FCS ...
-
bioRxiv - Cell Biology 2024Quote: ... serum-starved RPE1 cells where trypsinized and 0.5×106 of the cells were resuspended in 20 μl of the P3 Primary Cell 4D-Nucleofector Kit buffer (Lonza). The cell suspension was then nucleoporated with reporter plasmids with DNA lesions and undamaged control plasmids ...
-
bioRxiv - Bioengineering 2023Quote: ... Both cell lines were maintained in an incubator at 37 °C and 5% CO2 and tested for Mycoplasma using MycoAlert Mycoplasma Detection Kit (Lonza) regularly.
-
bioRxiv - Cancer Biology 2023Quote: ... All cell lines were maintained at 37°C in 5% CO2 and frequently examined for mycoplasma contamination using the MycoAlert Mycoplasma Detection Kit (Lonza).
-
bioRxiv - Cancer Biology 2023Quote: ... All cell lines were grown at 37℃ and 5% CO2 and were tested for mycoplasma contamination using the MycoAlert PLUS Mycoplasma Testing Kit (Lonza) according to the manufacturer’s instructions.
-
bioRxiv - Bioengineering 2023Quote: NIH/3T3 fibroblasts were cultured at 37 °C and 5% CO2 in low-glucose Dulbecco’s modified Eagle’s medium (DMEM) supplemented with 10% fetal bovine serum (Lonza, Basel, Switzerland) and 1% penicillin/streptomycin antibiotic ...
-
bioRxiv - Physiology 2024Quote: ... of six genetically independent donors were grown as monolayers in 100% humidity and 5% CO2 at 37 1C in serum-free defined growth media (BEGM, Lonza). NHBEs (passage 3 ...
-
bioRxiv - Cell Biology 2024Quote: ... prepared in tris-acetate (40 mM)/EDTA (10 mM) buffer and 5 μl of GelStar Nucleic Acid Stain 10,000 x (Lonza, 50535). 20 μl per sample resulting from PCR were mixed with Blue/Orange loading buffer loading dye 6x (PROMEGA ...
-
bioRxiv - Cancer Biology 2024Quote: ... Cell lines were maintained at 37 °C in a humidified atmosphere containing 5% carbon dioxide (CO2) and were tested for mycoplasma contamination using MycoAlert Mycoplasma detection kit (Lonza).
-
bioRxiv - Molecular Biology 2024Quote: All cells were cultured at 37°C in 5% CO2 in humidified incubators and were free from mycoplasma (MycoAlert Detection Kit, Lonza). Human primary hepatic stellate cells used for the main experiments were from Lonza (HUCLS ...
-
bioRxiv - Cancer Biology 2024Quote: ... All cells were cultured at 37 °C in 5% CO2 and tested negative for mycoplasma contamination by MycoAlert mycoplasma detection kit (Lonza). Expression of doxycycline-inducible shRNA was induced by supplementing media with 0.1-1 µg/ml doxycycline for 6 days ...
-
bioRxiv - Molecular Biology 2021Quote: Telomerase human aortic endothelial cells (TeloHAECs) (ATCC, CRL-4052) were cultured in EBM-2 basal media (Lonza, 3156) supplemented with EGM-2 Bullet kit (Lonza ...
-
bioRxiv - Immunology 2021Quote: ... Approximately 15,000 HMEC-1 cells/100 μl were seeded on coated wells using EGM-2 media (Lonza, Switzerland) and incubated overnight either with conditioned media from toxin-treated iPSC-MSC or vehicle at 37 °C ...
-
bioRxiv - Neuroscience 2021Quote: ... counted and 2×106 cells were transfected using the Basic Nucleofector kit for primary neurons (VAPI-1003, Lonza) and the D-33 programme on the Amaxa Nucleofector II B device (Amaxa Biosystems) ...
-
bioRxiv - Cell Biology 2021Quote: ... three tendons were placed into 1mL of complete Fibroblast Growth Medium-2 (FGM; #CC-3132, Lonza, Basel, Switzerland) containing 0.075% w/v collagenase type 2 (C6885 ...
-
bioRxiv - Neuroscience 2022Quote: ... 20,000 cells were resuspended in 100 μL nucleofection buffer from Human Stem Cell Nucleofector™ Kit 2 (Lonza). Salsa6f-AAVS1 SHL plasmid Template (2 μg ...
-
bioRxiv - Bioengineering 2022Quote: ... The iECs were cultured in endothelial cell growth medium 2 kit supplemented into basal media (except hydrocortisone, Lonza) with 1x GlutaMax (ThermoFisher ...
-
bioRxiv - Bioengineering 2022Quote: ... VERO cells were cultured in Dulbecco’s modified Eagle’s medium (DMEM) supplemented with 10% fetal bovine serum (FBS) and 2 mM glutamine (Lonza). Cells were dislodged ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... Sf9 cells (4 x 105 cells*ml) in 2 ml of Insect-Xpress medium (Lonza; Cat#BE12-730P10) were transfected with recombinant bacmids using Cellfectin II reagent (Gibco-Thermo Fisher Scientific™ ...
-
bioRxiv - Cell Biology 2022Quote: ... EGM-2 was then added to each well along with 200µl of normal human lung fibroblasts (CC2512, Lonza) at a concentration of 2×105 cells/ml ...
-
bioRxiv - Bioengineering 2019Quote: ... or γδ-T cells were activated and cultured for 2 days at 0.5 to 1.0 million cells/mL in XVivo15 medium (Lonza) with 5% Fetal Bovine Serum ...
-
bioRxiv - Bioengineering 2021Quote: ... and electroporated with 2-4pmol HDR template using a 4-D Nucleofector with pulse code CM-150 (Lonza). VLP/template mix was added to 15,000 cells in 50ul DMEM +10% FBS and 1x penicillin/streptomycin.
-
bioRxiv - Molecular Biology 2021Quote: ... at a density of 2 million cells/mL in serum-free cell culture medium (Lonza AG, Basel, Switzerland) supplemented with 0.5 μg/mL FMS-like tyrosine kinase-3 (Peprotech ...
-
bioRxiv - Cell Biology 2024Quote: ... These cells are mantained in 30% FBS/1% antibiotic/antimycotic /1% Non-essential AA/ EGM-2 media (Lonza) with Laminin521 coating (5 μg/ml ...
-
bioRxiv - Microbiology 2024Quote: ... Agarose pads were prepared by pipetting 550 µL of M8T with 2% molten agarose (Lonza, Cat. no. 50081) into each quadrant of a 4-chamber glass-bottom dish (Cellvis ...
-
bioRxiv - Bioengineering 2023Quote: ... were cultured using the EGM™-2 MV Microvascular Endothelial Cell Growth Medium BulletKit™ (Lonza, CC-3202), which contains hydrocortisone ...
-
bioRxiv - Genetics 2023Quote: ... 2−106 lymphoblastoid cells were suspended in 100 μL of Nucleofector C solution (VCA-1004, Lonza Cologne AG) with 0.6 μM RNAi and transfected with the Z-001 program according to manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2023Quote: ... All cells were used at passage 1-2 and were growth arrested in smooth muscle basal media (Lonza) supplemented with 0.3% FBS for 24-48 h before beginning experiments ...
-
bioRxiv - Genomics 2023Quote: 2 × 105 HCT116-Cas9 and iPSC-iCas9 were resuspended in 20 µl SE cell line nucleofection solution (Lonza) (HCT116-Cas9 ...
-
bioRxiv - Molecular Biology 2023Quote: ... ∼2-4 million cells were electroporated using the T-020 method of the Nucleofector™ 2b device (Lonza). Immediately after electroporation ...
-
bioRxiv - Cell Biology 2023Quote: ... with a blue fluorescent protein (BFP)-tag were cultured in smooth muscle cell growth medium-2 (SMGM2) (Lonza). Human umbilical cord vein endothelial cells (HUVEC ...
-
bioRxiv - Biochemistry 2023Quote: ... Briefly, D.mel-2 cells (CRL-1963, ATCC) were grown at 25°C in Insect-Xpress medium (181562, Lonza) supplemented with 1% Pen/Strep (15140122 ...
-
bioRxiv - Biophysics 2023Quote: Human aortic endothelial cells (ATCC, Manassas, VA) were cultured in EGM-2 culture media (Lonza Walkersville, Basel, Switzerland) on 0.1% gelatin-coated plastic dishes until ∼80% confluence ...
-
bioRxiv - Genetics 2023Quote: VSMCs were cultured in SmGM-2 medium supplemented with SMBM growth factors (Lonza, CC-4149 and CC-3181) in gelatin-coated dishes and incubated at 37°C with 5% CO2 ...
-
bioRxiv - Cell Biology 2020Quote: ... 5 × 103 cells were plated in low-attachment 96-well plates containing 100 μL MEGM media (without BPE) (Lonza, CC-3150), 20 ng/mL bFGF (Sigma Aldrich) ...
-
bioRxiv - Cell Biology 2021Quote: Cell lines were cultured according to standard aseptic mammalian tissue culture protocols in 5% CO2 at 37 °C with regular testing for mycoplasma contamination using the MycoAlert™ Mycoplasma Detection Kit (Lonza). HCT 116 ...
-
bioRxiv - Molecular Biology 2022Quote: HeLa cervical carcinoma cells were grown under a humidified 5% CO2 atmosphere at 37°C in Dulbecco’s modified Eagle’s medium (DMEM, Lonza, Alpharetta, GA, USA) supplemented with 10% fetal bovine serum (Thermo Fisher Scientific ...
-
bioRxiv - Cancer Biology 2021Quote: ... and immortalized human Brain Microvascular Endothelial cells (HBMEC) were seeded at 5000 cells/cm2 in EBM supplemented with 5% FBS and EGM supplements (all products, Lonza Bioscience) until reaching confluence 42,43 ...
-
bioRxiv - Neuroscience 2022Quote: ... cellular ATP content was measured two-three times a week between 5-7.5 weeks post transduction using the ViaLight Plus kit (Lonza, LT07-221) or ATPlite kit (PerkinElmer ...
-
bioRxiv - Developmental Biology 2019Quote: ... E14 cells (5 × 106) were transfected with 10 μg of the appropriate plasmid with the Mouse ES Cell Nucleofector™ Kit (Lonza) and allowed to grow for 48h after transfection ...
-
bioRxiv - Immunology 2021Quote: ... were washed in PBS/0.5%BSA and resuspended in 100 µl Nucleofector solution (Amaxa™ P3 Primary Cell 4D Nucleofector TM X Kit L, Lonza) with 4-6 µl of the appropriate siRNA (20-40 µM ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... RBD-Fc stable clone was obtained by electroporation with 2×106 cells and 5 μg endotoxin-free plasmids using Amaxa kit V and program U24 with Amaxa Nucleofector 2B (Lonza, Switzerland). Electroporated cells were subsequently plated in 96-wells at 500 cells/well in Plating Medium containing 80% EX CELL® CHO Cloning Medium (Cat.no C6366 ...
-
bioRxiv - Physiology 2022Quote: ... 1 million cells were washed with PBS and electroporated with 5-10 μg of appropriate plasmid using Amaxa cell nucleofector kit T (Lonza laboratories). Cells were allowed to recover for 48 h ...
-
bioRxiv - Molecular Biology 2022Quote: ... collected by centrifugation at 500xg for 5 min and resuspended in SF solution (SF cell line 4D-Nucleofector™ X Kit, Lonza). After addition of the RNP ...