Labshake search
Citations for Lonza :
1151 - 1200 of 1255 citations for 5 Isobutyl thiophene 2 carbaldehyde since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genetics 2023Quote: ... 2 day pre-stimulated CD34+ HSPCs were washed in PBS before being resuspended in P3 nucleofector solution (Lonza, V4XP-3032). An equivalent of 2.5×105 CD34+ HSPCs were mixed with gRNA:Cas9 complexes and 3 µg ssDNA donor template (20 μL ...
-
bioRxiv - Immunology 2023Quote: ... and cultured in 96-well culture plates (2×103 cells/well) with serum or EP-stimulated MDMs supernatants in X-VIVO 15 medium (Lonza) with 10 U/mL of IL-2 (PeproTech ...
-
bioRxiv - Developmental Biology 2023Quote: ... An mTmG lens carrying the MLR39-Cre allele was placed in a small hole in the center of an agarose pad that was prepared by loading 1 mL of 2% agarose (SeaKem GTG, Lonza) in M199 on the surface of 35 mm glass-bottom dish (3970-035 ...
-
bioRxiv - Cell Biology 2023Quote: ... JAWS transfection was achieved using 20 μg DNA and 2 x 106 million cells per 100 μl nucleofection solution from the Amaxa Nucleofector Mouse Dendritic Cell kit (Lonza), and the Y-001 program ...
-
bioRxiv - Molecular Biology 2023Quote: ... spanning the whole SARS-CoV-2 genome was transfected into 2×106 HEK293T cells using the SF Cell Line 4D-Nucleofector-X Kit (Cat# V4XC-2012, Lonza) and the 4D-Nucleofector X Unit (Lonza ...
-
bioRxiv - Microbiology 2023Quote: ... Stable cell lines were generated by nucleofecting 2 µg of pBud-PCID2-Flag plasmid or empty pBud as control using Amaxa Nucleofector (Lonza) and Nucleofector Kit R (Lonza ...
-
bioRxiv - Molecular Biology 2024Quote: HUVEC were grown at 80% confluence (5×103 cells per well) on glass coverslips in a 24-well plate and starved overnight in serum-free medium (EBM-2, Lonza). They were then incubated for 24 hr in EGM2 containing 10µM BrdU ...
-
bioRxiv - Plant Biology 2024Quote: ... The fixed cells were washed three times with the same buffer and then embedded in 2 % low-melting-temperature agarose (SeaPlaque, Lonza). The embedded samples were post-fixed with 4 % potassium permanganate at 4 °C for 2 h ...
-
bioRxiv - Cell Biology 2024Quote: ... Large scale D.Mel-2 cultures were prepared by diluting cells to a density of 106 cells/mL in Insect Xpress culture medium (Lonza) in Erlenmeyer flasks ...
-
bioRxiv - Bioengineering 2024Quote: ... HSPCs (2×105 cells/condition) were transfected with RNP complexes using the P3 Primary Cell 4D-Nucleofector X Kit (Lonza) and the CA137 program (Nucleofector 4D ...
-
bioRxiv - Bioengineering 2024Quote: ... NHDF cells were cultured in FBM fibroblast basal media (supplemented with FGM-2 SingleQuot supplements: insulin, hEGF-B, GA-1000, and FBS) (Lonza). NHEK cells were expanded in KBM gold basal medium (KGM gold supplemented with Lonza’s SingleQuot supplements ...
-
bioRxiv - Cancer Biology 2024Quote: ... were isolated from 8 to 16-week-old Rptorfl/fl or Tsc2fl/fl mice and maintained in EGM-2 medium (Lonza), as previously described71–75 ...
-
bioRxiv - Cancer Biology 2024Quote: ... The OCI-LY3 cell line was cultured in IMDM with 25 mM HEPES and 2 mM L-glutamine (Lonza; Switzerland), supplemented with P/S ...
-
bioRxiv - Cancer Biology 2024Quote: ... by flushing one femur with PBS 2% FBS followed by erythrocyte elimination with ACK Lysing Buffer (10-548E, BioWhittaker, Lonza) (Figure 4BC) ...
-
bioRxiv - Cancer Biology 2020Quote: ... All cell lines were cultured at 37°C and 5% CO2 in DMEM (H3BE12-604F/U1, Lonza Group AG [Cultek S.L.U, Madrid, Spain]) supplemented with 10% tetracycline-free FBS (631106 ...
-
bioRxiv - Molecular Biology 2021Quote: ... and Alt-R™ HDR donor oligo 5’ GTGTTTAGAAAAAAAAGAGTGTTTTTTTACCAGGGCCTTTGGCTCTTCCAGGAAGCAGATGTCCGAGTCGGAATATAATAACCCTTTCATACTCTTG 3’ (PS modification, antisense; IDT) using a 4D-nucleofector System X Unit (Lonza, Basel, Switzerland) and the P3 primary Cell 4D-Nucleofector® X kit (#V4XP-3024 ...
-
bioRxiv - Microbiology 2020Quote: ... The final extension step was extended for 5 minutes and product size was confirmed by electrophoresis with a FlashGel™ DNA Kit (Lonza, Basel, Switzerland). PCR products were then purified with the DNA Clean & Concentrator kit ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... Cells are spun at 1250 x g for 5 minutes and resuspended in 25 µl Lonza SF buffer (Lonza Cat. No. V4SC-2960) if cycloheximide selection will not be used or 200 µl of SF buffer if cycloheximide selection will be used.
-
bioRxiv - Molecular Biology 2023Quote: ... were grown in 10 cm2 dishes in a humidified environment at 37°C with 5% CO2 in DMEM/F12 medium (Lonza Ltd. Basel, Switzerland) supplemented with 10% fetal bovine serum (FBS ...
-
bioRxiv - Molecular Biology 2023Quote: ... were expanded in 10 cm2 dishes in a humidified environment at 37°C with 5% CO2 in DMEM/F12 medium (Lonza Ltd. Basel, Switzerland) supplemented with 12.5% fetal bovine serum (FBS ...
-
bioRxiv - Microbiology 2023Quote: ... plates were incubated at 37°C for 30 minutes in blocking buffer (PBS with 1% BSA, 5% FBS, and 1% human AB serum (Lonza, Walkersville, MD, USA), washed three times in PBS with 0.05% tween 20 and incubated with a commercial anti-SARS-CoV-2 Spike antibody (1/1000 ...
-
bioRxiv - Cancer Biology 2023Quote: ... Cells were incubated at 37°C in a humidified incubator with 5% CO2 and frequently tested for mycoplasma contamination using MycoAlert™ detection kit (Lonza, LT07-118).
-
bioRxiv - Immunology 2023Quote: ... Cells were cultured at 37°C with 5% CO2 and were regularly tested for mycoplasma contamination using the MycoAlert® PLUS Mycoplasma Detection Kit (Lonza, LT07-703), and authenticated by Microsynth ...
-
bioRxiv - Cancer Biology 2024Quote: ... 1×106 T cells were transfected with Cas9/RNPs complexes of CD38 targeting guide RNA 5’-AGUGUAUGGGAUGCUUUCAA -3’ (Synthego) using Lonza 4D-Nucleofector™ X Unit (Lonza, AAF-1003X). Transfection was carried out in P3 Primary Cell 4D-Nucleofector™ Solution (Lonza ...
-
bioRxiv - Synthetic Biology 2021Quote: ... and γδ T cells were activated at 1 x 106 cells mL-1 for 2 days in complete XVivo15 medium (Lonza) (5% fetal bovine serum ...
-
bioRxiv - Molecular Biology 2021Quote: ... Cells were electroporated with enhancer (IDT, #1075915, final concentration 4 μM) in a nucleofector device (Lonza, Nucleofector 2; program D-032). Cells were incubated for 24 h to allow them to recover and then detached and cloned by serial dilution ...
-
bioRxiv - Immunology 2022Quote: ... The concentration of IL-2 was increased to 1000 IU/ml on day 7 and the expanded T cells were electroporated with the indicated mRNA at a concentration of 2 pg mRNA/cell on day 8 using 4D Nucleofector™ System (Lonza) according to the manufacturer’s instructions ...
-
bioRxiv - Bioengineering 2019Quote: ... The plate containing the amplified genes or qPCR products was kept in ice and observed in a 2% agarose gel (NuSieve® 3:1 Agarose (Lonza)) to check and reinforce the identity of the amplicons ...
-
bioRxiv - Microbiology 2019Quote: ... the antibody-virus mixture was aspirated and Vero cells were washed with PBS and overlaid with DMEM containing 2% heat-inactivated FBS and 1% SeaPlaque Agarose (Lonza, 50501). After 4–6 days ...
-
bioRxiv - Genomics 2019Quote: ... The complex was then transferred to a 20 μl single-cell suspension of 2 × 105 hESCs in P3 nucleofection solution and electroporated using Amaxa 4D-Nucleofector™ (Lonza) with program CA137 ...
-
bioRxiv - Microbiology 2021Quote: ... pcDNA3-JUP or empty vector were transfected into Caco-2 cells using SE Cell Line 4D-Nucleofector™ X Kit (Lonza) and an Amaxa 4D Nucleofector device from Lonza ...
-
bioRxiv - Cancer Biology 2021Quote: ... expressing the human CD133 antigen45 was co-delivered with a PBase expression vector (2.5 μg) into 2 ⨯ 106 U251 cells using Nucleofector 2b (Lonza, Köln, Germany), followed by puromycin (500 ng/ml ...
-
bioRxiv - Bioengineering 2020Quote: 2 million UCB-MNC/mL were cultured in X-VIVO 15 serum-free cell-culture medium (Lonza Group Ltd, Basel, Switzerland), supplemented with 0.5 μg/mL of FMS-like tyrosine kinase-3 and 0.5 μg/mL of stem-cell factor ...
-
bioRxiv - Bioengineering 2022Quote: ... the basal channels of the Intestine Chips were first rinsed with endothelial cell culture medium consisting of stem cell medium supplemented with components from EGM™-2 MV Microvascular Endothelial SingleQuots Kit (CC-4147; Lonza), and then 50 μL HIMECS (450,000 cells/chip ...
-
bioRxiv - Genomics 2021Quote: ... The medium was changed to fresh fibroblast medium containing β-mercaptoethanol on day 2 and to a defined hepatocyte growth medium (HCM, Lonza) on day On day 6 ...
-
bioRxiv - Developmental Biology 2022Quote: ... Days 5-10 (hepatoblast differentiation/ Stage 2) switched to complete Hepatocyte Culture Medium (HCM) (consisting of HBM Basal Medium and HCM SingleQuot Supplements (Lonza, UK)) containing 20 ng/ ml BMP2 and 30 ng/ ml FGF2 (both Peprotech) ...
-
bioRxiv - Pathology 2020Quote: ... The purity of the final recombinant proteins was determined to be more than 99% by sodium dodecyl sulfate and polyacrylamide gel (SDS-PAGE) with an endotoxin concentration lower than 2 units/mg protein measured by Limulus Amebocyte Lysate PYROGENT™ 125 Plus (Lonza). In previous experiments we demonstrated that these recombinant proteins were functionally devoid of significant endotoxin contamination ...
-
bioRxiv - Immunology 2020Quote: ... The inoculum was then removed and replaced with 2 mL of complete DMEM medium with 1% SeaPlaque agarose (Lonza, Cat# 50100). The plate was incubated at 37°C and 5% CO2 for 3 days ...
-
bioRxiv - Biochemistry 2021Quote: ... 500,000 cells were seeded per well and 2 days later the experiment was started by replacing the culture medium with 2.5 ml Pro293a medium (Lonza, Basel, Switzerland), supplemented with 2 mM L-glutamine and 100 units pen/strep (Gibco ...
-
bioRxiv - Cell Biology 2021Quote: ... and Subset Four (podoplanin+CD36+) were sorted into 5mL FACS tubes containing endothelial basal media (EGM-2 medium without supplements added, Lonza, USA) supplemented with 10% FBS at 4°C degrees ...
-
bioRxiv - Physiology 2022Quote: ... A second enrichment with anti-CD102-coated Dynabeads was performed before culturing cells at 37Cº on fibronectin-coated tissue culture dishes in EGM-2 media (Lonza Walkersville). Cells (passage two ...
-
bioRxiv - Immunology 2023Quote: ... vectors was performed on day 2 of activation into 1×106 T cells using 4D-Nucleofector according to the manufacturer’s instructions (Lonza, Cologne, Germany).
-
bioRxiv - Cell Biology 2023Quote: ... Human visceral pre-adipocytes were purchased from Lonza (PT-5005) and cultured according to the manufacturer’s instructions in PGM-2TM Preadipocyte Growth Medium-2 BulletKitTM from Lonza (PT-8002). Once cells were expanded ...
-
bioRxiv - Cancer Biology 2023Quote: ... HUVEC cells were maintained in growth factor-supplemented media (EBM + EGM-2 aliquots + 10% FBS) from Lonza (C-3121, CC-4542). MDA-MB-231 cell line was modified to express GFP (green fluorescent protein ...
-
bioRxiv - Molecular Biology 2023Quote: ... Cells were infected with virus dilutions (from 10-1 to 10-9) prepared in DMEM supplemented with 2% FBS and 1%Penicillin/Streptomycin mixture (Lonza Biosciences). Infected cells were incubated at 37°C for 7 to 15 days ...
-
bioRxiv - Immunology 2024Quote: ... and spun at 200xg for 10 min and resuspended at a concentration of 2-10x106 cells/100µL in Lonza Buffer P3/supplement (Lonza #V4XP-3024). The RNP complex and 100µL of resuspended cells were combined and electroporated using pulse code EO-115 on the Lonza 4D-Nucleofector Core/X Unit.
-
bioRxiv - Microbiology 2024Quote: ... Passage 2 cells were transferred to 75 mL flasks and grown in confluence in Dulbecco Modified Eagle medium (DMEM) (Lonza BioWhittaker) containing 10% heat-inactivated fetal bovine serum (Gibco ...
-
bioRxiv - Neuroscience 2024Quote: ... digested for 3 min at 37 °C in Accutase and then resuspended in 60 μL nucleofection buffer from the Human Stem Cell Nucleofector™ Kit 2 (Lonza). The suspension was combined 2 μM Electroporation Enhancer (IDTDNA ...
-
bioRxiv - Microbiology 2024Quote: ... falciparum strains were cultured at 2% haematocrit in O+ erythrocytes and RPMI-1640 medium (Lonza, BE12-167F or Gibco, 31870-025) supplemented to give the following final concentrations ...
-
bioRxiv - Molecular Biology 2024Quote: ... HSVECs were obtained by enzymatic collagenase digestion of human saphenous veins (Ethics 15/ES/0094) and maintained in EC growth medium (EGM-2 BulletKit™) (Lonza) supplemented with foetal bovine serum (10% ...