Labshake search
Citations for Lonza :
1151 - 1200 of 1465 citations for 2 4 Methyl 5 thiazolyl ethyl decanoate since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2023Quote: ... complexes for each peak to be deleted were prepared individually by mixing 120 pmol of sgRNA with 20 pmol of Cas9 protein (QB3 MacroLab, University of California, Berkeley) in 5 ul of P3 primary cell nucleofection buffer (Lonza) and incubated at room temperature for 15 minutes ...
-
bioRxiv - Microbiology 2023Quote: BHK-21 cells (clone BSRT7/5) constitutively expressing the T7 RNA polymerase47 were grown in Dulbeco Modified Essential Medium (Lonza) supplemented with 10% fetal calf serum (FCS) ...
-
bioRxiv - Cell Biology 2023Quote: HEK293T cells were grown in fifteen 25 cm2 flasks at 37°C in 5% CO2 using Dulbecco’s Modified Eagle Medium (Lonza, USA) supplemented with 10% FBS (Gibco ...
-
bioRxiv - Developmental Biology 2023Quote: ... Cells were used at passages 3-5 for experiments and cultured at 37°C and 5% CO2 in complete EC basal medium containing growth factors EGM2-Bulletkit (Lonza) to ensure a stable environment for optimal cell growth ...
-
bioRxiv - Molecular Biology 2023Quote: ... 5-6 million primary human keratinocytes were electroporated with 1 nmol siPools using the Amaxa human keratinocyte Nucleofector kit (Lonza) according to the manufacturer’s instructions and the T-018 program of the Amaxa Nucleofector II device (Lonza) ...
-
bioRxiv - Developmental Biology 2023Quote: iPSCs were transfected with sgRNA 3’ UCCCUUUCCUCAGGUCACAG 5’ (Synthego) via nucleofection using program CA137 on a 4D Nucleofactor X (Lonza) as per manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2022Quote: ... All cells were maintained at 37°C and 5% CO2 and 95% relative humidity and regularly tested negative for mycoplasma infection by Mycoalert detection kit (Lonza). For 3D growth conditions ...
-
bioRxiv - Cell Biology 2022Quote: ... Two million of MNCs were transfected with 10 μg of plasmid (5:1 ratio pEB-C5:pEBTg) as instructed by the Lonza CD34+ nucleofector kit (VPA-1003, Lonza) and Amaxa nucleofector (program T-016 ...
-
bioRxiv - Cell Biology 2024Quote: ... Two million E14 ESCs were nucleofected with paired Kdm3b targeting and donor plasmids (5 µg each) using the Amaxa 4D-Nucleofector protocol (Lonza) and selected with blasticidin S hydrochloride (Research Products International ...
-
bioRxiv - Cell Biology 2024Quote: ... serum-starved RPE1 cells where trypsinized and 0.5×106 of the cells were resuspended in 20 μl of the P3 Primary Cell 4D-Nucleofector Kit buffer (Lonza). The cell suspension was then nucleoporated with reporter plasmids with DNA lesions and undamaged control plasmids ...
-
bioRxiv - Bioengineering 2023Quote: ... Both cell lines were maintained in an incubator at 37 °C and 5% CO2 and tested for Mycoplasma using MycoAlert Mycoplasma Detection Kit (Lonza) regularly.
-
bioRxiv - Cancer Biology 2023Quote: ... All cell lines were maintained at 37°C in 5% CO2 and frequently examined for mycoplasma contamination using the MycoAlert Mycoplasma Detection Kit (Lonza).
-
bioRxiv - Bioengineering 2023Quote: NIH/3T3 fibroblasts were cultured at 37 °C and 5% CO2 in low-glucose Dulbecco’s modified Eagle’s medium (DMEM) supplemented with 10% fetal bovine serum (Lonza, Basel, Switzerland) and 1% penicillin/streptomycin antibiotic ...
-
bioRxiv - Physiology 2024Quote: ... of six genetically independent donors were grown as monolayers in 100% humidity and 5% CO2 at 37 1C in serum-free defined growth media (BEGM, Lonza). NHBEs (passage 3 ...
-
bioRxiv - Immunology 2022Quote: ... Cryopreserved PBMC (5 x 106/sample) were thawed in prewarmed RPMI-1640 media supplemented with L-glutamine (Lonza, Basel, Switzerland) + 10% FCS ...
-
bioRxiv - Cell Biology 2024Quote: ... prepared in tris-acetate (40 mM)/EDTA (10 mM) buffer and 5 μl of GelStar Nucleic Acid Stain 10,000 x (Lonza, 50535). 20 μl per sample resulting from PCR were mixed with Blue/Orange loading buffer loading dye 6x (PROMEGA ...
-
bioRxiv - Cancer Biology 2024Quote: ... Cell lines were maintained at 37 °C in a humidified atmosphere containing 5% carbon dioxide (CO2) and were tested for mycoplasma contamination using MycoAlert Mycoplasma detection kit (Lonza).
-
bioRxiv - Molecular Biology 2024Quote: All cells were cultured at 37°C in 5% CO2 in humidified incubators and were free from mycoplasma (MycoAlert Detection Kit, Lonza). Human primary hepatic stellate cells used for the main experiments were from Lonza (HUCLS ...
-
bioRxiv - Cancer Biology 2024Quote: ... All cells were cultured at 37 °C in 5% CO2 and tested negative for mycoplasma contamination by MycoAlert mycoplasma detection kit (Lonza). Expression of doxycycline-inducible shRNA was induced by supplementing media with 0.1-1 µg/ml doxycycline for 6 days ...
-
bioRxiv - Cancer Biology 2024Quote: ... Cells were grown at 37°C in a humidified incubator with 5% CO2 and were regularly performed mycoplasma test using a MycoAlert Mycoplasma Detection kit (Lonza). Cells with mycoplasma-free were used for experiments.
-
bioRxiv - Cancer Biology 2024Quote: ... All cells were maintained at 37 °C in a 5% CO2 humidified atmosphere and regularly screened for the presence of mycoplasma using the MycoAlert Mycoplasma Detection Kit (Lonza). Cell lines were cultured for no more than 20 passages following thawing ...
-
bioRxiv - Biochemistry 2024Quote: ... All cells were cultured at 37°C in 5% CO2 in humidified incubators and were free from mycoplasma (MycoAlert Detection Kit, Lonza).
-
bioRxiv - Genetics 2024Quote: ... Cells were cultured at 37°C in a humidified atmosphere and 5% CO2 in a 1:1 mixture of DMEM (Lonza) and Ham’s F10 (Lonza ...
-
bioRxiv - Molecular Biology 2021Quote: Telomerase human aortic endothelial cells (TeloHAECs) (ATCC, CRL-4052) were cultured in EBM-2 basal media (Lonza, 3156) supplemented with EGM-2 Bullet kit (Lonza ...
-
bioRxiv - Immunology 2021Quote: ... Approximately 15,000 HMEC-1 cells/100 μl were seeded on coated wells using EGM-2 media (Lonza, Switzerland) and incubated overnight either with conditioned media from toxin-treated iPSC-MSC or vehicle at 37 °C ...
-
bioRxiv - Neuroscience 2021Quote: ... counted and 2×106 cells were transfected using the Basic Nucleofector kit for primary neurons (VAPI-1003, Lonza) and the D-33 programme on the Amaxa Nucleofector II B device (Amaxa Biosystems) ...
-
bioRxiv - Cell Biology 2021Quote: ... three tendons were placed into 1mL of complete Fibroblast Growth Medium-2 (FGM; #CC-3132, Lonza, Basel, Switzerland) containing 0.075% w/v collagenase type 2 (C6885 ...
-
bioRxiv - Neuroscience 2022Quote: ... 20,000 cells were resuspended in 100 μL nucleofection buffer from Human Stem Cell Nucleofector™ Kit 2 (Lonza). Salsa6f-AAVS1 SHL plasmid Template (2 μg ...
-
bioRxiv - Bioengineering 2022Quote: ... The iECs were cultured in endothelial cell growth medium 2 kit supplemented into basal media (except hydrocortisone, Lonza) with 1x GlutaMax (ThermoFisher ...
-
bioRxiv - Bioengineering 2022Quote: ... VERO cells were cultured in Dulbecco’s modified Eagle’s medium (DMEM) supplemented with 10% fetal bovine serum (FBS) and 2 mM glutamine (Lonza). Cells were dislodged ...
-
bioRxiv - Cell Biology 2022Quote: ... EGM-2 was then added to each well along with 200µl of normal human lung fibroblasts (CC2512, Lonza) at a concentration of 2×105 cells/ml ...
-
bioRxiv - Molecular Biology 2021Quote: ... at a density of 2 million cells/mL in serum-free cell culture medium (Lonza AG, Basel, Switzerland) supplemented with 0.5 μg/mL FMS-like tyrosine kinase-3 (Peprotech ...
-
bioRxiv - Genomics 2023Quote: 2 × 105 HCT116-Cas9 and iPSC-iCas9 were resuspended in 20 µl SE cell line nucleofection solution (Lonza) (HCT116-Cas9 ...
-
bioRxiv - Cell Biology 2024Quote: ... These cells are mantained in 30% FBS/1% antibiotic/antimycotic /1% Non-essential AA/ EGM-2 media (Lonza) with Laminin521 coating (5 μg/ml ...
-
bioRxiv - Microbiology 2024Quote: ... Agarose pads were prepared by pipetting 550 µL of M8T with 2% molten agarose (Lonza, Cat. no. 50081) into each quadrant of a 4-chamber glass-bottom dish (Cellvis ...
-
bioRxiv - Bioengineering 2023Quote: ... were cultured using the EGM™-2 MV Microvascular Endothelial Cell Growth Medium BulletKit™ (Lonza, CC-3202), which contains hydrocortisone ...
-
bioRxiv - Genetics 2023Quote: ... 2−106 lymphoblastoid cells were suspended in 100 μL of Nucleofector C solution (VCA-1004, Lonza Cologne AG) with 0.6 μM RNAi and transfected with the Z-001 program according to manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2023Quote: ... All cells were used at passage 1-2 and were growth arrested in smooth muscle basal media (Lonza) supplemented with 0.3% FBS for 24-48 h before beginning experiments ...
-
bioRxiv - Biophysics 2023Quote: Human aortic endothelial cells (ATCC, Manassas, VA) were cultured in EGM-2 culture media (Lonza Walkersville, Basel, Switzerland) on 0.1% gelatin-coated plastic dishes until ∼80% confluence ...
-
bioRxiv - Genetics 2023Quote: VSMCs were cultured in SmGM-2 medium supplemented with SMBM growth factors (Lonza, CC-4149 and CC-3181) in gelatin-coated dishes and incubated at 37°C with 5% CO2 ...
-
bioRxiv - Cell Biology 2023Quote: ... with a blue fluorescent protein (BFP)-tag were cultured in smooth muscle cell growth medium-2 (SMGM2) (Lonza). Human umbilical cord vein endothelial cells (HUVEC ...
-
bioRxiv - Biochemistry 2023Quote: ... Briefly, D.mel-2 cells (CRL-1963, ATCC) were grown at 25°C in Insect-Xpress medium (181562, Lonza) supplemented with 1% Pen/Strep (15140122 ...
-
bioRxiv - Microbiology 2024Quote: ... We add 2-ml per well of the secondary overlay containing 1.5% Sekam ME Agarose (Lonza, Cat. # 50011), 2X EMEM (Quality Biological ...
-
bioRxiv - Bioengineering 2024Quote: ... were co-transfected with 2 µg plasmid-expressing guide RNA using a stem cell nucleofector kit (Lonza, Amaxa). Multiple guide RNAs were used to generate a collection of isogenic mutant cell lines ...
-
bioRxiv - Bioengineering 2024Quote: ... The endothelial cells and fibroblasts were cultured in microvascular endothelial cell growth medium (MVECPRO2: Lonza EGM-2 MV) and fibroblast media (Stromal cells/fibroblasts ...
-
bioRxiv - Cell Biology 2024Quote: All eight guide plasmids (4 for Sun1 and 4 for Sun2) were transfected into A549 cells using the Amaxa Cell Line Nucleofector Kit T (Lonza Bioscience, VCA-1002) according to the manufacturer’s instructions and plated into a 10cm plate in A549 media ...
-
bioRxiv - Cell Biology 2020Quote: ... 5 × 103 cells were plated in low-attachment 96-well plates containing 100 μL MEGM media (without BPE) (Lonza, CC-3150), 20 ng/mL bFGF (Sigma Aldrich) ...
-
bioRxiv - Cell Biology 2021Quote: Cell lines were cultured according to standard aseptic mammalian tissue culture protocols in 5% CO2 at 37 °C with regular testing for mycoplasma contamination using the MycoAlert™ Mycoplasma Detection Kit (Lonza). HCT 116 ...
-
bioRxiv - Molecular Biology 2022Quote: HeLa cervical carcinoma cells were grown under a humidified 5% CO2 atmosphere at 37°C in Dulbecco’s modified Eagle’s medium (DMEM, Lonza, Alpharetta, GA, USA) supplemented with 10% fetal bovine serum (Thermo Fisher Scientific ...
-
bioRxiv - Cancer Biology 2021Quote: ... and immortalized human Brain Microvascular Endothelial cells (HBMEC) were seeded at 5000 cells/cm2 in EBM supplemented with 5% FBS and EGM supplements (all products, Lonza Bioscience) until reaching confluence 42,43 ...