Labshake search
Citations for Lonza :
1101 - 1150 of 1709 citations for Total Carbohydrate Microplate Assay Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2024Quote: ... 16.4µl P3 and 3.6µl Supplement Reaction solutions from P3 Primary Cell 4D X Kit S (Lonza V4XP-3032) were added ...
-
bioRxiv - Biochemistry 2023Quote: ... Cell lines were tested once a month for mycoplasma contamination using Mycoalert® Detection Kit (Lonza, Basel, Switzerland). MCF7 and MDA-468 cells were grown in RPMI 1640 medium (Thermo Fisher Scientific ...
-
bioRxiv - Synthetic Biology 2023Quote: ... 1 × 106 HEK293T cells were transfected using SF Cell Line 4D-NucleofectorTM X Kit S (Lonza, V4XC-2012) with 7 µg of 5’ modified donor ...
-
bioRxiv - Synthetic Biology 2024Quote: ... and Jurkat cell lines tested negative for mycoplasma with the MycoAlert Mycoplasma Detection Kit (Lonza Cat #LT07-318).
-
bioRxiv - Immunology 2023Quote: ... 1×10e6 cells per guide were electroporated with the corresponding RNP complex using Lonza Electroporation Kit V (Lonza). After 48 h ...
-
Vps18 contributes to phagosome membrane integrity in Mycobacterium tuberculosis-infected macrophagesbioRxiv - Microbiology 2023Quote: ... and nucleofection was performed as per the manufacturer’s recommendations (Lonza, SG Cell Line 4D-Nucleofector X Kit S). Monoclonal isolation of the knockouts were performed by limiting dilution ...
-
bioRxiv - Molecular Biology 2024Quote: ... iMEPM cells were tested for mycoplasma contamination using the MycoAlert Mycoplasma Detection Kit (Lonza Group Ltd, Basel, Switzerland). Packaged lentiviruses containing pLV[shRNA]-EGFP:T2A:Puro-U6>Scramble_shRNA (vectorID ...
-
bioRxiv - Neuroscience 2024Quote: ... we used the 4D-Nucleofector system and Amaxa P3 primary Cell 4D-Nucleofector X Kit S from Lonza. The electroporation buffer used was P3 primary cell Nucleofector Solution with Supplement 1 (Lonza) ...
-
bioRxiv - Molecular Biology 2024Quote: ... siRNA transfections were performed using the 4D-Nucleofector and the SE cell line 4D-Nucleofector X kits (Lonza) according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2024Quote: ... containing the appropriate guide RNA (gRNA) sequences (CGCTCAACTCGGCCATGCGC; GCAACAGATGGAAGGCCTCC) using the AmaxaTM nucleofectorTM kit V (Lonza #VCA-1003). Monoclonal lines were screened for puromycin sensitivity ...
-
bioRxiv - Cell Biology 2020Quote: ... or a FOXO1-targeted siRNA (GAGCGUGCCCUACUUCAAGGA) using the Amaxa(tm) Basic Nucleofector(tm) Kit for Primary Mammalian Fibroblasts (Lonza), according to the manufacturer’s protocol ...
-
bioRxiv - Genetics 2021Quote: ... Two million WTC iPSC were nucleofected using an Amaxa nucleofector 2B and the Nucleofector Kit C (both from Lonza), 0.5 µg of each AAVS1 TALEN pair and 1 µg of the donor plasmid (see Figure S4) ...
-
bioRxiv - Microbiology 2021Quote: ... All the cells used in this study tested negative for mycoplasma contamination using MycoAlert™ Mycoplasma detection kit (Lonza).
-
bioRxiv - Molecular Biology 2021Quote: ... siRNA transfections were performed using the 4D-Nucleofector and the SE cell line 4D-Nucleofector X kit L (Lonza) according to the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2021Quote: ... Cellular ATP levels were detected 20 h after glutamate exposure using the ViaLight™ Plus-Kit (Lonza, Verviers, Belgium) following the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2021Quote: ... The cell density was counted and ∼2.5 × 105 cells were transfected with indicated constructs by using P3 Primary Cell 4D-Nucleofector X kit (Lonza). After transfection ...
-
bioRxiv - Immunology 2020Quote: ... All cells were confirmed to be free of mycoplasmas before injection into mice by the MycoAlert detection kit (Lonza). Tumor growth was monitored using an electronic caliper and volumes were determined using the following formula ...
-
bioRxiv - Genomics 2019Quote: The input library plasmids were electroporated into the K562 cells with Cell Line Nucleofector Kit V (Lonza, VCA-1003). For each electroporation ...
-
bioRxiv - Microbiology 2020Quote: ... Cell lines were authenticated by morphologic evaluation and were checked for mycoplasma contamination (MycoAlertTM PLUS Mycoplasma Detection Kit, Lonza).
-
bioRxiv - Neuroscience 2019Quote: ... 8 × 105 cells were co-transfected with 3 µg plasmid-sgRNA construct and ssODN (0.6 µM final concentration) with Amaxa Human Stem Cell Nucleofector Kit 1 (Lonza) and program A-023 for the Amaxa Nucleofector Device II ...
-
bioRxiv - Genetics 2019Quote: ... Hela cells were electroporated with plasmids using Ingenio electroporation kit (SopaChem) and the Nucleofector™ II/2b device (Lonza). Cells were harvested 24h post-electroporation ...
-
bioRxiv - Developmental Biology 2020Quote: ... Cells were transfected using the P3 Primary Cell 4D-Nucleofector™ X Kit S (Lonza-BioResearch, Cat #: V4XP-3032) and Amaxa™ 4D-Nucleofector™ (Lonza-BioResearch) ...
-
bioRxiv - Cell Biology 2019Quote: ... The cells were then mixed with 100uL of SE Cell Line 4D-Nucleofector® X Kit (Lonza, Basel, Switzerland) and transfected with 65nM siRNA diluted in MilliQ sterile-filtered water using the 4D-Nucleofector (Lonza ...
-
bioRxiv - Immunology 2019Quote: ... Pre-activated B cells were transfected using the P4 Primary Cell 4D-Nucleofector X Kit L (Lonza, V4XP-4024) in combination with the program DI-100 ...
-
bioRxiv - Immunology 2019Quote: ... Endotoxin concentrations were measured in all protein samples using the Limulus Amebocyte Lysate Kit – QCL-1000 (Lonza, Basel, Switzerland). The rMIC1 ...
-
bioRxiv - Genomics 2020Quote: ... 1 million U2OS cells were transfected using the Nucleofector 2b with 2 μg Plasmid DNA using kit V (Lonza) according the manufacturer’s instructions.
-
bioRxiv - Developmental Biology 2021Quote: ... pPBCAG-hph and a PiggyBac Transposase vector using the AMAXA Mouse Embryonic Stem Cell Nucleofector Kit (LONZA, VPH-1001). Transfected cells were selected with 200 μg/ml hygromycin B Gold (Ibian tech. ...
-
bioRxiv - Developmental Biology 2021Quote: ... 5×106 EL16.7 TST ESCs were nucleofected with the AMAXA Mouse Embryonic Stem Cell Nucleofector Kit (LONZA, VPH-1001) using program A-30 with 1.6 µg each of GFP and tdTomato circularised targeting vectors and 5 µg single gRNA vector PX459 (5’-TATACCTAATCATTATGCCG-3’ ...
-
bioRxiv - Immunology 2021Quote: ... The siRNA duplexes were used to transfect purified human naïve B cells using the Human B Cell NucleofectorTM Kit (VPA-1001, LONZA). Transfected B cells were then stimulated with CpG ODN 2395 plus IL-2 and IL-21 for 96 h before genomic DNA extraction for analysis of Sμ-σδand Sμ-Sγ1 DNA recombination ...
-
bioRxiv - Neuroscience 2020Quote: ... 2×105 dissociated neurons were transfected with Lonza Nucleofector using the Basic Neuron SCN Nucleofector kit (Lonza, Basel, Switzerland). Transfected neurons were incubated for indicating days and processed for subsequent analyses.
-
bioRxiv - Cancer Biology 2021Quote: ... The siRNA transfections for primary BMDMs and pancreatic fibroblasts were performed using the Mouse Macrophage Nucleofector™ Kit (Lonza) and Nucleofector™ 2b Device (Lonza ...
-
bioRxiv - Cancer Biology 2020Quote: ... E4ORF1-transduced primary human umbilical vein endothelial cells (HUVECs) were cultured using the EGM-2 Bullet Kit (Lonza, Germany). All cell lines were kept at 37°C and 5% CO2 in a fully humidified incubator and negatively tested for mycoplasma by PCR.
-
bioRxiv - Systems Biology 2021Quote: ... Cells were transfected with 250 nM of siRNA and 1 μl of control pMax GFP (Nucleofector X kit, Lonza), using the CU-133 program ...
-
bioRxiv - Microbiology 2021Quote: ... berghei ANKA using the parasite nucleofector II kit and the Nucleofector II device with the U-033 program (Lonza). Transfected parasites were injected intravenously into 5 - 7 weeks old female ddY mice ...
-
bioRxiv - Microbiology 2021Quote: ... Relative adenylate kinase levels were measured on 40μL of supernatants via the ToxiLightTM Non-Destructive Cytotoxicity BioAssay Kit (Lonza) according to the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2020Quote: ... pCAGIG-hA3A-BE3 plasmid was delivered into cells using SF Cell Line 4D-Nucleofector X Kit (Lonza, #V4XC-2032) using programme CA-137 ...
-
bioRxiv - Bioengineering 2020Quote: ... Cells were routinely tested for mycoplasma every 6 months to ensure cell quality (MycoAlert™ Mycoplasma Detection Kit; Lonza).
-
bioRxiv - Neuroscience 2022Quote: ... 1 x 106 NSCs were mixed with 2.5 µg of corresponding DNA using Amaxa P4 Primary Cell 4D-Nucleofector X Kit S (Lonza) with CA137 programme in a 4D-Nucleofector X Unit (Lonza) ...
-
bioRxiv - Cancer Biology 2022Quote: ... 5 μg of DNA was used to transfect the cells using the Amaxa Cell Line Nucleofector kit (Lonza Bioscience) according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2022Quote: ... 300 pmol of HDR oligonucleotide was electroporated into one million HEK293 Flp-In T-Rex cells along with 2.5 μg each of pSpCas9(BB)-2A-Puro and BiP gRNA plasmid (Amaxa kit R, program A-24; Lonza). Immediately after electroporation ...
-
bioRxiv - Molecular Biology 2022Quote: ... All cells were free of Mycoplasma contamination as confirmed by routine testing using the MycoAlert Mycoplasma Detection Kit (Lonza).
-
bioRxiv - Microbiology 2022Quote: ... and resuspended in 100 μL nucleofector solution at a concentration of 1.5 x 106 cells/100 μl following the instructions of the Nucleofector Kit V (Lonza). In vitro transcribed RNA (5 μg ...
-
bioRxiv - Cancer Biology 2022Quote: ... Mycoplasma contamination of the cells were checked monthly using the MycoAlert Plus Mycoplasma Detection Kit (cat# LT07-703) (Lonza) following the manufacturer’s protocol ...
-
bioRxiv - Developmental Biology 2022Quote: ... and 1 million cells were transfected with 2μg of donor vector and 2μg of each AAVS1 ZFN expression plasmids using the P3 Primary Cell 4D-Nucleofector X Kit (Lonza). Cells were seeded in E8 medium supplemented with 10µM ROCK Inhibitor Y-27632 (Selleckchem) ...
-
bioRxiv - Developmental Biology 2020Quote: ... expressing Cas9 and single sgRNAs targeting upstream and downstream regions of the lncRNA promoter/locus were co-transfected into 1.5 × 106 H1 hESCs using the Human Stem Cell Nucleofector Kit 2 (Lonza) and the Amaxa Nucleofector II (Lonza) ...
-
bioRxiv - Cancer Biology 2019Quote: ... Cells were washed with RPMI before being re-suspended in Lonza electroporation solution from Kit C (Lonza, Basel, Switzerland) and electroporated using program W-001 using the Amaxa nucleofector (Lonza ...
-
bioRxiv - Microbiology 2021Quote: ... Pre-assembled Cas9-gRNA RNPs were electroporated into cells using Lonza Human T cell Nucleofector kit (Lonza, VPA-1002) and the Nucleofector2b equipment ...
-
bioRxiv - Microbiology 2021Quote: ... Cells were tested for Mycoplasma contamination every 4 - 6 weeks and before each experiment (Mycoalert Mycoplasma Detection kit, Lonza).
-
bioRxiv - Cell Biology 2022Quote: ... the genetic transformation of RAW 264.7 cells was obtained by nucleofection using the Amaxa Cell Line Nucleofector Kit V (Lonza) for RAW 264.7 and following the protocol for Amaxa Nucleofector ...
-
bioRxiv - Immunology 2022Quote: ... were cultured in EBM-2 supplemented with EGM-2 endothelial growth SingleQuot kit supplement & growth factors (Lonza, the Netherlands). All of the cell lines used in this study tested negative for the presence of Mycoplasma spp ...