Labshake search
Citations for Lonza :
1101 - 1150 of 1717 citations for Rat Dual Specificity Mitogen Activated Protein Kinase Kinase 7 MAP2K7 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2022Quote: ... Transient transfections of these dominant-negative Rab11 a and siRab11 a into mouse MΦs (RAW 264.7 cell line) were performed with Amaxa mouse macrophage nucleofector kit (VPA-1009, Lonza) and DharmaFECT 4 Transfection Reagent (T-2004-01 ...
-
bioRxiv - Cell Biology 2022Quote: ... All cell lines were routinely tested for mycoplasma contamination by using the MycoAlert PLUS Mycoplasma Detection Kit (Lonza).
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... Cultures were confirmed to be free of mycoplasma infection using the MycoAlert Mycoplasma Detection Kit (Lonza, Walkersville, MD). Briefly ...
-
bioRxiv - Microbiology 2023Quote: ... Parasites and host cells were regularly tested for Mycoplasma contamination using the Mycoalert detection kit (Lonza; Basel, Switzerland). For all assays ...
-
bioRxiv - Molecular Biology 2023Quote: ... All cell lines were frequently tested for mycoplasma using MycoAlert Plus Mycoplasma Detection Kit (cat# LT07-218, Lonza).
-
bioRxiv - Cancer Biology 2022Quote: ... Cell lines were periodically tested to confirm Mycoplasma negativity using the MycoAlert mycoplasma Detection Kit (Lonza, Visp, Switzerland). Detailed methods for additional cell lines derived from solid tumors and leukemia are provided in Supplementary Materials and Methods.
-
bioRxiv - Immunology 2023Quote: Electroporation was performed to introduce siRNA into BMDCs using a mouse dendritic cell nucleofector kit (Lonza, Basel, Switzerland) and a Nucleofector 2b (Lonza) ...
-
bioRxiv - Molecular Biology 2023Quote: ... All cell lines were routinely tested for mycoplasma contamination by the MycoAlert Mycoplasma Detection Kit (Lonza #LT07-318).
-
bioRxiv - Immunology 2023Quote: ... The MPRA vector library was nucleofected into TPP macrophages (5µg vector into 5×106 cells) in 100μl nucleofection buffer (Human Macrophage Nucleofection Kit, Lonza) using a Nucleofector 2b (program Y-011) ...
-
bioRxiv - Developmental Biology 2023Quote: ... or pcDNA3.1(-) as a control using the AMAXA SG Cell line kit (4D-Nucleofector program EO-100; Lonza). Cells were further cultivated in DMEM/F12 supplemented with 10% FBS (Sigma ...
-
bioRxiv - Immunology 2023Quote: ... beads were removed on day 3 followed by electroporation using the Human T Cell Nucleofector™ Kit (Lonza) and the Amaxa Nucleofactor® 2b (Lonza ...
-
bioRxiv - Neuroscience 2023Quote: ... CRISPR reagents were transfected into iPSCs using the P3 Primary Cell 4D Nucleofector™ X Kit S (Lonza), as previously described (Deneault et al. ...
-
bioRxiv - Molecular Biology 2023Quote: ... and resuspended carefully in 20ul 4D-Nucleofector™ Solution (SE Cell Line 4D-Nucleofector™ X Kit, Lonza). Thereafter ...
-
bioRxiv - Immunology 2023Quote: ... The P14 cell/Cas9/RNP mixes were transferred to Nucleofection cuvette strips (4D-Nucleofector X kit S; Lonza). Cells were electroporated using a 4D nucleofector (4D-Nucleofector Core Unit ...
-
A spatially resolved EGFR signaling model predicts the length scale of GAB1-SHP2 complex persistencebioRxiv - Systems Biology 2023Quote: ... Cells were confirmed to be mycoplasma-negative using the MycoAlert Mycoplasma Detection Kit (LT07-318; Lonza, Basel, Switzerland).
-
bioRxiv - Cancer Biology 2023Quote: ... All cell lines were tested negative for mycoplasma contamination with MycoAlert® Mycoplasma Detection Kit (Lonza, LT07-118).
-
bioRxiv - Cell Biology 2023Quote: ... dermal fibroblasts were expanded and verified mycoplasm negative via MycoAlert™ PLUS Mycoplasma Detection Kit (Lonza, 75860-362) infected with Sendai virus containing Yamanaka factors from the CytoTune™-iPS 2.0 Sendai Reprogramming Kit (ThermoFisher ...
-
bioRxiv - Cell Biology 2023Quote: ... All human cell lines were tested for Mycoplasma contamination using a MycoAlert Mycoplasma Detection Kit (Lonza, Basel, Switzerland).
-
bioRxiv - Cell Biology 2023Quote: PC12 cells were transfected with 300 nM siRNA by electroporation using the Cell Line Nucleofector Kit V (Lonza), following the manufacturer’s instructions ...
-
Hallmark molecular and pathological features of POLG disease are recapitulated in cerebral organoidsbioRxiv - Cell Biology 2023Quote: ... Regular monitoring for mycoplasma contamination was performed using the Myco Alert™ Mycoplasma Detection Kit (Lonza, #LT07-218) to ensure the integrity of the cell lines.
-
bioRxiv - Immunology 2024Quote: ... 1 - 2.5 × 106 Jurkat T cells were resuspended in EP buffer from the Nucleofector® Kit V (Lonza). Cells were combined with 1.5 μg of donor plasmid in a reaction volume of 100 μL and electroporated on the Amaxa® Nucleofector® II using pulse code X-005.
-
bioRxiv - Immunology 2024Quote: ... 16.4µl P3 and 3.6µl Supplement Reaction solutions from P3 Primary Cell 4D X Kit S (Lonza V4XP-3032) were added ...
-
bioRxiv - Biochemistry 2023Quote: ... Cell lines were tested once a month for mycoplasma contamination using Mycoalert® Detection Kit (Lonza, Basel, Switzerland). MCF7 and MDA-468 cells were grown in RPMI 1640 medium (Thermo Fisher Scientific ...
-
bioRxiv - Synthetic Biology 2023Quote: ... 1 × 106 HEK293T cells were transfected using SF Cell Line 4D-NucleofectorTM X Kit S (Lonza, V4XC-2012) with 7 µg of 5’ modified donor ...
-
bioRxiv - Synthetic Biology 2024Quote: ... and Jurkat cell lines tested negative for mycoplasma with the MycoAlert Mycoplasma Detection Kit (Lonza Cat #LT07-318).
-
bioRxiv - Immunology 2023Quote: ... 1×10e6 cells per guide were electroporated with the corresponding RNP complex using Lonza Electroporation Kit V (Lonza). After 48 h ...
-
Vps18 contributes to phagosome membrane integrity in Mycobacterium tuberculosis-infected macrophagesbioRxiv - Microbiology 2023Quote: ... and nucleofection was performed as per the manufacturer’s recommendations (Lonza, SG Cell Line 4D-Nucleofector X Kit S). Monoclonal isolation of the knockouts were performed by limiting dilution ...
-
bioRxiv - Molecular Biology 2024Quote: ... iMEPM cells were tested for mycoplasma contamination using the MycoAlert Mycoplasma Detection Kit (Lonza Group Ltd, Basel, Switzerland). Packaged lentiviruses containing pLV[shRNA]-EGFP:T2A:Puro-U6>Scramble_shRNA (vectorID ...
-
bioRxiv - Neuroscience 2024Quote: ... we used the 4D-Nucleofector system and Amaxa P3 primary Cell 4D-Nucleofector X Kit S from Lonza. The electroporation buffer used was P3 primary cell Nucleofector Solution with Supplement 1 (Lonza) ...
-
bioRxiv - Molecular Biology 2024Quote: ... siRNA transfections were performed using the 4D-Nucleofector and the SE cell line 4D-Nucleofector X kits (Lonza) according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2024Quote: ... containing the appropriate guide RNA (gRNA) sequences (CGCTCAACTCGGCCATGCGC; GCAACAGATGGAAGGCCTCC) using the AmaxaTM nucleofectorTM kit V (Lonza #VCA-1003). Monoclonal lines were screened for puromycin sensitivity ...
-
bioRxiv - Cell Biology 2020Quote: ... or a FOXO1-targeted siRNA (GAGCGUGCCCUACUUCAAGGA) using the Amaxa(tm) Basic Nucleofector(tm) Kit for Primary Mammalian Fibroblasts (Lonza), according to the manufacturer’s protocol ...
-
bioRxiv - Genetics 2021Quote: ... Two million WTC iPSC were nucleofected using an Amaxa nucleofector 2B and the Nucleofector Kit C (both from Lonza), 0.5 µg of each AAVS1 TALEN pair and 1 µg of the donor plasmid (see Figure S4) ...
-
bioRxiv - Microbiology 2021Quote: ... All the cells used in this study tested negative for mycoplasma contamination using MycoAlert™ Mycoplasma detection kit (Lonza).
-
bioRxiv - Molecular Biology 2021Quote: ... siRNA transfections were performed using the 4D-Nucleofector and the SE cell line 4D-Nucleofector X kit L (Lonza) according to the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2021Quote: ... Cellular ATP levels were detected 20 h after glutamate exposure using the ViaLight™ Plus-Kit (Lonza, Verviers, Belgium) following the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2021Quote: ... The cell density was counted and ∼2.5 × 105 cells were transfected with indicated constructs by using P3 Primary Cell 4D-Nucleofector X kit (Lonza). After transfection ...
-
bioRxiv - Immunology 2020Quote: ... All cells were confirmed to be free of mycoplasmas before injection into mice by the MycoAlert detection kit (Lonza). Tumor growth was monitored using an electronic caliper and volumes were determined using the following formula ...
-
bioRxiv - Genomics 2019Quote: The input library plasmids were electroporated into the K562 cells with Cell Line Nucleofector Kit V (Lonza, VCA-1003). For each electroporation ...
-
bioRxiv - Microbiology 2020Quote: ... Cell lines were authenticated by morphologic evaluation and were checked for mycoplasma contamination (MycoAlertTM PLUS Mycoplasma Detection Kit, Lonza).
-
bioRxiv - Neuroscience 2019Quote: ... 8 × 105 cells were co-transfected with 3 µg plasmid-sgRNA construct and ssODN (0.6 µM final concentration) with Amaxa Human Stem Cell Nucleofector Kit 1 (Lonza) and program A-023 for the Amaxa Nucleofector Device II ...
-
bioRxiv - Genetics 2019Quote: ... Hela cells were electroporated with plasmids using Ingenio electroporation kit (SopaChem) and the Nucleofector™ II/2b device (Lonza). Cells were harvested 24h post-electroporation ...
-
bioRxiv - Developmental Biology 2020Quote: ... Cells were transfected using the P3 Primary Cell 4D-Nucleofector™ X Kit S (Lonza-BioResearch, Cat #: V4XP-3032) and Amaxa™ 4D-Nucleofector™ (Lonza-BioResearch) ...
-
bioRxiv - Cell Biology 2019Quote: ... The cells were then mixed with 100uL of SE Cell Line 4D-Nucleofector® X Kit (Lonza, Basel, Switzerland) and transfected with 65nM siRNA diluted in MilliQ sterile-filtered water using the 4D-Nucleofector (Lonza ...
-
bioRxiv - Genomics 2020Quote: ... 1 million U2OS cells were transfected using the Nucleofector 2b with 2 μg Plasmid DNA using kit V (Lonza) according the manufacturer’s instructions.
-
bioRxiv - Developmental Biology 2021Quote: ... pPBCAG-hph and a PiggyBac Transposase vector using the AMAXA Mouse Embryonic Stem Cell Nucleofector Kit (LONZA, VPH-1001). Transfected cells were selected with 200 μg/ml hygromycin B Gold (Ibian tech. ...
-
bioRxiv - Developmental Biology 2021Quote: ... 5×106 EL16.7 TST ESCs were nucleofected with the AMAXA Mouse Embryonic Stem Cell Nucleofector Kit (LONZA, VPH-1001) using program A-30 with 1.6 µg each of GFP and tdTomato circularised targeting vectors and 5 µg single gRNA vector PX459 (5’-TATACCTAATCATTATGCCG-3’ ...
-
bioRxiv - Immunology 2021Quote: ... The siRNA duplexes were used to transfect purified human naïve B cells using the Human B Cell NucleofectorTM Kit (VPA-1001, LONZA). Transfected B cells were then stimulated with CpG ODN 2395 plus IL-2 and IL-21 for 96 h before genomic DNA extraction for analysis of Sμ-σδand Sμ-Sγ1 DNA recombination ...
-
bioRxiv - Neuroscience 2020Quote: ... 2×105 dissociated neurons were transfected with Lonza Nucleofector using the Basic Neuron SCN Nucleofector kit (Lonza, Basel, Switzerland). Transfected neurons were incubated for indicating days and processed for subsequent analyses.
-
bioRxiv - Cancer Biology 2021Quote: ... The siRNA transfections for primary BMDMs and pancreatic fibroblasts were performed using the Mouse Macrophage Nucleofector™ Kit (Lonza) and Nucleofector™ 2b Device (Lonza ...