Labshake search
Citations for Lonza :
1101 - 1150 of 2027 citations for Ethyl 2 pyrrolidin 2 yl 2 3 dihydro 1 3 thiazole 4 carboxylate hydrochloride since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2023Quote: Human primary pulmonary artery ECs (HPAECs) were obtained from ATCC and grown on gelatin-coated dishes in Endothelial Cell Basal Medium-2 (Lonza, Catalog # CC-3156) supplemented with EGM-2 SingleQuots Supplements (Lonza ...
-
bioRxiv - Immunology 2024Quote: ... including the use of 2 mM EDTA in PBS as the wash buffer and red blood cell lysis with ACK lysis buffer (Lonza by Thermo Fisher). Subsequently ...
-
bioRxiv - Microbiology 2021Quote: ... All amplified PCR products were electrophoretically analyzed in 3% agarose gel (MetaPhor Agarose, Lonza Group) stained with 0.5 μg/mL ethidium bromide ...
-
bioRxiv - Microbiology 2023Quote: ... Cells were resuspended in 3 mL TheraPEAK™ ACK Lysing Buffer (1X) (Lonza, Basel, Switzerland). After a 2 minute incubation ...
-
bioRxiv - Molecular Biology 2022Quote: ... 3 × 107 cells per plug were embedded in 0.4% SeaPlaque low-melting-point agarose (Lonza) and in the presence of 75 mM EDTA ...
-
bioRxiv - Bioengineering 2023Quote: ... T cells were cultured for 3 days in X-VIVOTM 15 medium (BE02-060F; Lonza) supplemented with 5 ng/mL of IL-15 (130-093-955 ...
-
bioRxiv - Immunology 2024Quote: ... For transient transfection 1e6 Jurkat cells were transfected with 2 μg DNA using the LONZA electroporator (program X-001) and Nucleofector Kit V (Lonza, catalog no. VCA-1003) 24 h prior to imaging ...
-
bioRxiv - Immunology 2024Quote: RAW264.7 Mφs (2 x 106, ATCC, Cat# ATCC TIB-71) were electroporated (Amaxa® Cell Line Nucleofector® Kit V, LONZA; Cat#VCA-1003) with 5 µg of HA-HIF1alpha (Addgene#18949 ...
-
bioRxiv - Immunology 2024Quote: RAW264.7 Mφs (2 x 106, ATCC, Cat# ATCC TIB-71) were electroporated (Amaxa® Cell Line Nucleofector® Kit V, LONZA; Cat#VCA-1003) with 0.5 µM of scrambled (ThermoFisher ...
-
bioRxiv - Immunology 2024Quote: ... KR-F or DF-F) and cultured at low passages (p = 2-7) using either the KGM™ Keratinocyte Growth Medium BulletKit™ (Lonza; CC-3111) for KCs or DMEM supplemented with 10% FBS ...
-
bioRxiv - Biophysics 2021Quote: Commercially available primary human umbilical vein endothelial cells (HUVECs) (pooled, passages 3-5, Lonza, Basel, Switzerland) were grown in EGM-2 medium (Lonza ...
-
bioRxiv - Genetics 2021Quote: ... The short pvT1 amplicons were size-separated by electrophoresis in a 3% NuSieve (Lonza, Basel, Switzerland) agarose gel ...
-
bioRxiv - Developmental Biology 2020Quote: ... The cell suspensions were mixed with ultra low melting agarose solution (3% SeaPrep®, LONZA, #50302) in a volume ratio of 1:1 and were loaded onto the two aqueous phase inlets of the FFD ...
-
bioRxiv - Immunology 2022Quote: ... The isolated splenocytes were incubated for 3 mins in red blood cell lysis with ACK (Lonza) followed by washing with media ...
-
bioRxiv - Biophysics 2020Quote: ... ∼300 pairs of ovaries were harvested from 3-6 day old females in 1X PBS (Lonza) with 1 mM DTT (Sigma ...
-
bioRxiv - Immunology 2020Quote: ... Antibodies which contained endotoxin levels above 3 EU/ml (Kinetic-QCL Kinetic Chromogenic LAL Assay, Lonza) were depleted of endotoxin with the ToxinEraser Endotoxin Removal kit (GenScript ...
-
bioRxiv - Bioengineering 2024Quote: Bone marrow organoids were fabricated by seeding 3 × 103 mesenchymal stem cells (hMSC, Lonza, PT-2501) and 6 × 103 human bone marrow CD34+ cells (STEMCELL Technologies ...
-
bioRxiv - Cancer Biology 2023Quote: ... The absence of Mycoplasma contamination was verified every 3 weeks with the MycoAlert detection kit (Lonza). Previously described patient-derived short-term cultures (<10) ...
-
bioRxiv - Molecular Biology 2023Quote: ... Dinucleosome-sized DNA fragments were purified and excised from a 3% NuSieve GTG agarose gel (Lonza) using the Zymoclean Gel DNA Recovery Kit (Zymo Research) ...
-
bioRxiv - Biochemistry 2023Quote: ... Virus was concentrated using ultracentrifugation (95000 g for 3 hr) and suspended using OPTI-MEM (Lonza). Viral transfections assays were performed by plating target 293T (ACE2+ve ...
-
bioRxiv - Immunology 2024Quote: ... The bEnd.3 cells were cultured in DMEM supplemented with L-glutamine (BE17-605 F; Lonza), Na-pyruvate (S-8636 ...
-
bioRxiv - Neuroscience 2021Quote: ... LUHMES cells were electroporated and transfected with 2 μg of plasmid using the Amaxa™ Basic Primary Neurons Nucleofector™ Kit and protocol (Lonza, cat. # VPI-1003). Transfected cells were selected by flow-sorting for DAPI negative ...
-
bioRxiv - Microbiology 2023Quote: ... and placed into a sterile 2 mm gap cuvette with the appropriate DNA and transfected using an Amaxa Nucleofector II (Lonza, Basel, Switzerland; U-33 program). Parasites were immediately transferred to LIT medium for 24 hours before adding 10 μg/mL puromycin (Invivogen ...
-
bioRxiv - Bioengineering 2022Quote: ... was dissolved for at least 3 hrs at 37 °C in Dulbecco’s Phosphate-Buffered Saline (DPBS, Lonza) at twice the final concentration ...
-
bioRxiv - Immunology 2022Quote: Calu-3 cell line was obtained from ATCC and maintained in Eagle’s Minimum Essential Medium(EMEM; Lonza) supplemented with 10% fetal bovine serum (FBS) ...
-
bioRxiv - Immunology 2022Quote: Calu-3 lung carcinoma cells (HTB-55; ATCC) were cultured in Eagle’s minimum essential medium (EMEM, Lonza), supplemented with 9% fetal calf serum (FCS ...
-
bioRxiv - Cell Biology 2022Quote: ... Electroporation with the CA-137 program was performed 3-5 min after this addition (Lonza Group AG). Following this ...
-
bioRxiv - Cell Biology 2024Quote: ... and subsequently combined with 3 µl RNPs before being transferred to a 96-well electroporation plate (Lonza). Electroporation was performed using the pulse code EH115 on a 4D-Nucleofector 96-well Unit (Lonza ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: Human umbilical vein endothelial cells (HUVEC) cells were grown at 37° C in the Endothelial cell basal medium-2 (LONZA #Cat No-CC-3156 and CC-4176) under the atmosphere containing 5% CO2 ...
-
bioRxiv - Biochemistry 2021Quote: ∼300 pairs of ovaries per replicate were harvested from 3-6 day old females in 1X PBS (Lonza) with 1 mM DTT (Sigma ...
-
bioRxiv - Bioengineering 2021Quote: ... All cell lines were tested for mycoplasma every 3 months using MycoAlert Mycoplasma Detection Kit (Lonza, Basel, Switzerland). All cells used were <20 passages from thaw.
-
bioRxiv - Immunology 2021Quote: ... and suspended at a concentration of 3 × 106cells/mL in RPMI-1640 (BioWhittaker®, Lonza, Walkersville, MD, USA) containing 15% heat-inactivated horse serum ...
-
bioRxiv - Microbiology 2021Quote: ... The human lung epithelial cell line Calu-3 (ATCC HTB-55) was maintained in DMEM F-12 (Lonza) supplemented with 10% FBS ...
-
bioRxiv - Cell Biology 2023Quote: Bone marrow derived DCs at day 7 (3×106) were transfected with 100μl of the Amaxa solution (Lonza) containing siRNA (control or target-specific ...
-
bioRxiv - Immunology 2023Quote: ... beads were removed on day 3 followed by electroporation using the Human T Cell Nucleofector™ Kit (Lonza) and the Amaxa Nucleofactor® 2b (Lonza ...
-
bioRxiv - Neuroscience 2022Quote: ... Electrophoresis of 10 µl of RT-PCR products was performed using 3% agarose (SeaKem LE Agarose by Lonza) with molecular ladder gel containing 0.5 µg/ml ethidium bromide in x0.5 tris-acetate-ethylenediaminetetraacetic acid (TAE ...
-
bioRxiv - Cell Biology 2023Quote: For immunoprecipitations performed on THP-1 cells were first transfected with 2 μg of empty vector pCDNA 3.1 or plasmid containing 3x FLAG_Vamp-3 using the Amaxa 4D nucleoporator system (Lonza) with the Amaxa SG Cell line kit and program FF-100 and following manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2023Quote: ... All cell lines were cultured less than 3 months after resuscitation and tested for contaminants using MycoAlert (Lonza) every 1-3 months to ensure they were free of Mycoplasma contamination.
-
bioRxiv - Microbiology 2024Quote: ... and sporozoites were collected by centrifugation at 2,500 rpm for 3 min and resuspended in SF buffer (Lonza) containing 50 mg of tagging plasmid or 30 mg of linear targeting template and 30 mg CRISPR/Cas9 plasmid in a total volume of 100 ml ...
-
bioRxiv - Biochemistry 2024Quote: ... 3×105 cells were electroporated using P3 Primary Cell Nucleofector® 4D Kit and Nucleofector 4D system (Lonza) with 400 ng donor DNA ...
-
bioRxiv - Cell Biology 2021Quote: ... siRNA directed against Dsg1 (Integrated DNA Technologies) with a targeting sequence 5′-CCATTAGAGAGTGGCAATAGGATGA-3′ using Amaxa Nucleofector System (Lonza) for electroporation of cells according to manufacturer’s instructions.
-
bioRxiv - Cancer Biology 2022Quote: ... 3 µL of the sgRNA (total 300 pmol) was added to 12 µL of SE buffer (Lonza V4XC-1032). In another well ...
-
bioRxiv - Biochemistry 2021Quote: ... For each nucleofection 3 x 106 cells were resuspended in 80 μl of mouse ES cell nucleofection solution (Lonza). Equimolar (0.32 nmol ...
-
bioRxiv - Cancer Biology 2020Quote: ... were used in passages 3-6 and cultured on 0.1% gelatin-coated tissue culture plates in complete EGM2 (Lonza) supplemented to a total of 10% Fetal Bovine Serum (FBS) ...
-
bioRxiv - Bioengineering 2024Quote: ... and SK-BR-3 cells (Korean Cell Line Bank, Korea) were cultured in Dulbecco’s modified Eagle’s medium (DMEM; Lonza, Switzerland) supplemented with 10 % (v/v ...
-
Self-organised pattern formation in the developing neural tube by a temporal relay of BMP signallingbioRxiv - Developmental Biology 2023Quote: A total of 3-4µg of plasmid DNA was electroporated into 3-4x106 early passage ES cells using the Amaxa Nucleofector II (Lonza) programme A-023 ...
-
bioRxiv - Cell Biology 2022Quote: Normal human bronchial epithelial cells (HBECs) from 3 independent donors (Supplemental Table S1) were obtained from Lonza (CC-2540) and cultured in BEGM growth media (Lonza CC-3170) ...
-
bioRxiv - Biophysics 2023Quote: ... DNA samples were also analyzed by electrophoresis through 1.5 % and 3 % agarose gels (Seakem LE agarose, Lonza, Rockland, ME) in TAE (Tris-acetate + 1 mM EDTA ...
-
bioRxiv - Genetics 2024Quote: ... Approximately 2.5×105 CD34+ HSPCs were mixed with gRNA:Cas9 complexes and 3 µg ssDNA donor template (20 μL) in nucleofector strip format (Lonza). Electroporation was performed in Unit X ...
-
bioRxiv - Neuroscience 2024Quote: ... and 300μM single stranded oligodeoxynucleotides (ssODN: 5’gggtccagggtggctgtcactcat ccttttttctggctaccaaaggtgcagataattaaGaagaagctggatcttagcaacgtccagccaagtgtggctcaaaggataatatc aaacacgtcc 3’) and the P3 Primary Cell 4D reaction mix (Lonza). We screened a minimum of 96 clones for genetic editing ...