Labshake search
Citations for Lonza :
1101 - 1150 of 2032 citations for 7 Chloro 1 2 3 4 tetrahydroisoquinoline since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2023Quote: ... with 0.05 mL blocking buffer (98% v/v FACS buffer (PBS + 2% v/v dFBS (Lonza)) and 2% v/v Fc receptor binding inhibitor (Thermo Fisher Scientific)) ...
-
bioRxiv - Immunology 2023Quote: ... 2 samples of 5x106 PBMCs were nucleofected in 100 mL of P3 buffer (Lonza; V4XP-3024) with 125 pmol of Alt-R Sp HiFi Cas 9 nuclease v3 (IDT ...
-
bioRxiv - Immunology 2023Quote: ... NIH) in 100 µl IMDM/Glutamax/ 10% FBS containing 2× MycoZap Plus-PR (Lonza #VZA-2021), 100 ng/ml human IL-2 (GoldBio #1110-02-50) ...
-
bioRxiv - Biophysics 2023Quote: The pellet of cells after electroporation was mixed with 2 % (w/w) SeaPrep agarose (Lonza, Switzerland) in DMEM at 37°C ...
-
bioRxiv - Bioengineering 2024Quote: ... which directly correlates to cellular metabolic activity.58 LSEC cells were maintained in EBM-2 (Lonza) media with EGM-2 BulletKit (Lonza) ...
-
bioRxiv - Biophysics 2024Quote: ... Young adult worms were placed on a thin layer of 2% agarose (Lonza, SeaKem LE agarose) prepared on a 24 × 55-mm coverslip (Matsunami Glass ...
-
bioRxiv - Neuroscience 2019Quote: ... 1% NEAA (Lonza), 1% N2 supplement (Thermo Scientific) ...
-
bioRxiv - Cancer Biology 2020Quote: ... 1% Ultraglutamine (Lonza)) in each well ...
-
bioRxiv - Genetics 2022Quote: ... 1% glutamine (Lonza) and 1% penicillin-streptomycin (Sigma) ...
-
bioRxiv - Molecular Biology 2021Quote: ... and Alt-R™ HDR donor oligo 5’ GTGTTTAGAAAAAAAAGAGTGTTTTTTTACCAGGGCCTTTGGCTCTTCCAGGAAGCAGATGTCCGAGTCGGAATATAATAACCCTTTCATACTCTTG 3’ (PS modification, antisense; IDT) using a 4D-nucleofector System X Unit (Lonza, Basel, Switzerland) and the P3 primary Cell 4D-Nucleofector® X kit (#V4XP-3024 ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: Five milligrams of niclosamide inhalation powder was loaded into size #3 hydroxypropyl methylcellulose capsules (Vcaps® plus, Capsugel®, Lonza, Morristown, NJ, USA). The aerodynamic properties of the powder were evaluated using a Next Generation Impactor (NGI ...
-
bioRxiv - Neuroscience 2022Quote: ... Harvested EBs were transferred to a tissue-culture treated 6-well plate (Falcon, #353224) in 3 ml of EB Differentiation media: X-VIVO 15 (Lonza Biosciences, #04-418Q) + 1% Glutamax (Life Technologies ...
-
bioRxiv - Cancer Biology 2024Quote: ... 1×106 T cells were transfected with Cas9/RNPs complexes of CD38 targeting guide RNA 5’-AGUGUAUGGGAUGCUUUCAA -3’ (Synthego) using Lonza 4D-Nucleofector™ X Unit (Lonza, AAF-1003X). Transfection was carried out in P3 Primary Cell 4D-Nucleofector™ Solution (Lonza ...
-
bioRxiv - Molecular Biology 2019Quote: ... ES cells were grown in 1:1 mixture of DMEM (Lonza BioWhittaker Cat ...
-
bioRxiv - Cell Biology 2021Quote: ... neutralized 1:1 with Trypsin Neutralising Solution (TNS, Lonza, #CC-5002), spun down and concentrated to 15*106 cells/mL in EGM-2 ...
-
bioRxiv - Microbiology 2021Quote: ... 1% penicillin/streptomycin and 1% sea-plaque agarose (Lonza, Walkersville, MD). After a 2-days incubation ...
-
bioRxiv - Microbiology 2022Quote: ... A 1:1 mixture of Bronchial Epithelial Cell Basal Medium (Lonza) with Dulbecco’s Modified Eagle Medium (DMEM ...
-
bioRxiv - Immunology 2024Quote: ... at a 1:1 ratio overnight in X Vivo-15 (Lonza) supplemented with 2% KnockOut serum replacement (ThermoFisher) ...
-
bioRxiv - Immunology 2021Quote: ... Buffy coat cells were washed three times in 2.5 mM EDTA-PBS at 4°C before dilution and maintenance in RPMI-1640 supplemented with 10% FCS (PAA, AT or Lonza, CH) 2 mM glutamine ...
-
bioRxiv - Genomics 2021Quote: The MPRA libraries were electroporated in 4 to 6 million cells each using the Nucleofector 2b or 4D (Lonza, Basel, Switzerland) with 6 µg of plasmid DNA and program T-030 or Y-001 and DS-132 ...
-
bioRxiv - Physiology 2022Quote: ... 5 million cells were washed with phosphate buffered saline (PBS) and electroporated with 4-6 μg of appropriate plasmid construct using an Amaxa cell nucleofector (Lonza laboratories) and nucleofection reagent (362.88 mM ATP-disodium salt ...
-
bioRxiv - Neuroscience 2023Quote: ... Nucleofection was performed using the 4-D nucleofector system (AMAXA) and the P3 Primary Cell 4D-Nucleofector Kit (Lonza, V4XP-3024) following manufactures’ instructions (program CB-150) ...
-
bioRxiv - Genetics 2021Quote: Human embryonic microglia clone 3 (HMC3, ATCC® CRL3304™) cells were cultured in minimum essential medium (MEM) Eagle-EBSS with NEAA without L-Glutamine (Lonza, Cologne, Germany) supplemented with 10% fetal bovine serum (Sigma-Aldrich ...
-
bioRxiv - Synthetic Biology 2021Quote: ... This mixture was nucleofected with 2×106 stimulated human primary T cells using the 4D-Nucleofector (Lonza) with the program EO-115 ...
-
bioRxiv - Cell Biology 2019Quote: ... Mycoplasma testing was performed on a regular basis (every 2 weeks) using the Mycoalert Detection Kit (Lonza).
-
bioRxiv - Genomics 2021Quote: ... PBMCs were then treated with 2 ml of erythrocytes lysis buffer (Lonza Walkersville inc. #120-02-070) for 1 min ...
-
bioRxiv - Developmental Biology 2021Quote: ... Cells were cultured on laminin-coated tissue culture flasks in SKGM-2 medium (Lonza®, Valkersville, MD). Medium was replaced every 3 days ...
-
bioRxiv - Genetics 2020Quote: ... Parasites were subsequently resuspended in 100 μL nucleofector solution of the Basic Parasite Nucleofector Kit 2 (Lonza), combined with 50 μL plasmid solution containing 5-10 μg DNA ...
-
bioRxiv - Bioengineering 2021Quote: Human umbilical vein endothelial cells (ECs) were cultured in endothelial growth medium (EGM-2; Lonza, Basel, Switzerland) supplemented with 1% penicillin-streptomycin-fungizone (Gibco ...
-
bioRxiv - Microbiology 2021Quote: Each transfection reaction was prepared by adding 2 µl of “primed” cells resuspended in SG buffer (Lonza) to a mixture of ...
-
bioRxiv - Cell Biology 2022Quote: ... Transient transfections of plasmids were performed 2 days before experiments using the Amaxa nucleofector (Lonza VPD-1004). The cells were detached with trypsin/EDTA ...
-
bioRxiv - Neuroscience 2020Quote: ... in EBM-2 medium supplemented with EGM-2MV SingleQuots (Lonza, Cat No CC-3156 and CC-4147) in an incubator set to 37 °C ...
-
bioRxiv - Cancer Biology 2021Quote: ... the digested splenic cells were cultured in endothelial cell growth medium EGM-2 (Cat# CC-3162, Lonza) at a density of 2-5 × 104/mL in fibronectin-coated culture flasks for 24 hours ...
-
bioRxiv - Cell Biology 2019Quote: ... while HMVEC-Lung and HMVEC-Colon were grown in EGM-2-MV medium (Lonza, Walkersville, MD, USA). Cells were used within 8 passages for all experiments.
-
bioRxiv - Cancer Biology 2019Quote: Human umbilical endothelial vein cells (HUVEC) were serum-starved overnight in EGM-2 media (Lonza, CC-3162) containing 0.2% FBS ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... Human umbilical venous endothelial cells (HUVECs) and EGM-2 bullet kits were obtained from Lonza (Basel, Switzerland).
-
bioRxiv - Cell Biology 2020Quote: ... Primary human pulmonary arterial smooth muscle cells (PASMCs) were cultured in SmGM-2 cell culture media (Lonza), and experiments were performed at passages 3 to 9 ...
-
bioRxiv - Immunology 2021Quote: ... 2 × 106 cells were suspended in 100 µL buffer (P3 Primary Cell 4D-Nucleofector X Kit, Lonza), mixed with 4 µg DNA and transfected using the 4D-Nucleofector program DN-100 ...
-
bioRxiv - Bioengineering 2024Quote: ... The hUVEC cells were cultured and expanded until passage 5 with EGM-2 media (CC-3156, Lonza) and SingleQuot supplements (CC-4176 ...
-
bioRxiv - Cell Biology 2024Quote: ... HMVEC-L were cultured in EGMTM-2MV Microvascular Endothelial Cell Growth Medium-2 BulletKitTM (Lonza, CC-3202) at 37°C ...
-
bioRxiv - Cell Biology 2024Quote: ... Eye enucleations were completed under aseptic conditions and maintained in EBM-2 media (CC-3156, Lonza, USA). All connective tissue was removed from the external part of the eyes and then the cornea ...
-
bioRxiv - Cancer Biology 2023Quote: ... M0 cells were then serum starved for 2 hours in X-VIVO™ hematopoietic cell medium (Lonza, Basel ...
-
bioRxiv - Microbiology 2023Quote: Caco-2 cells (human intestinal epithelial cell line) were cultured in DMEM - Dulbecco’s Modified Eagle Medium (Lonza) supplemented with 10% FBS (Gibco) ...
-
bioRxiv - Bioengineering 2023Quote: Primary NHLF were purchased from Lonza and subcultured for up to six passages in manufacturer supplied growth medium (FGM-2 BulletKit, CC3132, Lonza). The microtissues populated with NHLF were grown for 2 d before the addition of M2 macrophages at a ratio of 4:1 (M2 ...
-
bioRxiv - Neuroscience 2023Quote: ... HUVECs were transfected with 2 μg of RNF213 WT or R4810K construct using electroporation (Lonza, Basel, Switzerland), following the manufacturer’s protocol.
-
bioRxiv - Cell Biology 2024Quote: ... HMVEC-L were cultured in EGMTM-2MV Microvascular Endothelial Cell Growth Medium-2 BulletKitTM (Lonza, CC-3202) at 37°C ...
-
bioRxiv - Bioengineering 2024Quote: ... cells were thawed and expanded in EGM-2 endothelial cell growth medium (Lonza, cat. no. CC-3124) for two passages (P-2 ...
-
bioRxiv - Molecular Biology 2024Quote: ... ∼2 million cells were electroporated using the T-020 method of the Nucleofector™ 2b device (Lonza). Immediately after electroporation ...
-
bioRxiv - Cell Biology 2022Quote: hTERT immortalized RPE-1 (RPE1) cell lines were grown in an 1:1 mix of DMEM and F-10 (Lonza) and Human Embryonic Kidney (HEK ...
-
bioRxiv - Evolutionary Biology 2019Quote: ... 100mM EDTA at pH 8.0 and 1 mg ml−1 lysozyme and mixed with the same volume of 1% SeaKem Gold Agarose (Lonza, USA) in TE buffer containing 10 mM Tris ...