Labshake search
Citations for Lonza :
1051 - 1100 of 1765 citations for Rat Isotyping kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genomics 2021Quote: ... Cells were regularly passaged and tested for presence of mycoplasma contamination with MycoAlert Plus Mycoplasma Detection Kit (Lonza).
-
bioRxiv - Genomics 2021Quote: ... K562 cells were grown to 1×106 and transfected with 1,000ng of gRNA plasmid and 3,000 ng of pCMV_AncBE4max_P2A_GFP (Amaxa® Cell Line Nucleofector® Kit V, Lonza). K562 cells were cultured for an additional 48 hours then single clones of green cells were isolated using flow cytometry (Aria II) ...
-
bioRxiv - Molecular Biology 2020Quote: ... using the Cell Line Nucelofector Kit V and the Amaxa Nucleofector II Device (Lonza Group AG, Basel, CH). Stable cells were selected for with 1mg/mL hygromycin B (Invitrogen ...
-
bioRxiv - Cancer Biology 2021Quote: A human breast MCF10A cell line (CRL10317, ATCC) was grown with completed growth medium: MEGM Kit (Lonza CC3150) without gentamycin-amphotericin B mix (GA1000 ...
-
bioRxiv - Cancer Biology 2021Quote: ... fixed after 12 days and stained according to the OsteoImage™ Mineralisation Assay Lonza kit (PA-1503, Lonza) protocol ...
-
bioRxiv - Developmental Biology 2021Quote: ... 2×106 iPSC single cells were transfected using the Amaxa Human Stem Cell Nucleofector® Kit 2 (Lonza) with 4 μg ...
-
bioRxiv - Cell Biology 2020Quote: ... EB3-mCherry construct (Stepanova et al., 2003) was transiently transfected using Amaxa Cell Line Nucleofector kit V (Lonza), program X-001.
-
bioRxiv - Cell Biology 2020Quote: ... Both cell lines were regularly tested for mycoplasma contamination by MycoAlert PLUS Mycoplasma Detection Kit (Lonza, LT07-703). REF52 cells were transiently transfected with mEos3.2-Actin expression vector (Michael W ...
-
bioRxiv - Immunology 2022Quote: ... All cell lines were confirmed to be free of mycoplasmas using the MycoAlert detection kit (Lonza, Basel, Switzerland). Cells were detached in PBS EDTA 5mM without enzymatic solution to avoid HVEM cleavage.
-
bioRxiv - Cancer Biology 2022Quote: ... All cells were negative for Mycoplasma upon regular testing with the MycoAlert Mycoplasma Detection Kit (Lonza; LT07-318). LARP1 knockout cell line generation was performed using Edit-R™ CRISPR-Cas9 Gene Engineering ...
-
bioRxiv - Cancer Biology 2022Quote: ... All cell lines were routinely tested for mycoplasma contamination using MycoAlert PLUS mycoplasma detection kit (Lonza, MD, USA) and molecularly characterised using an “in house” panel of cellular and molecular markers to check that cell lines have not been cross contaminated (every 3-6 month) ...
-
bioRxiv - Biochemistry 2022Quote: ... Cell lines were regularly tested and verified to be mycoplasma negative using MycoAlert PLUS Mycoplasma Detection Kit (Lonza).
-
bioRxiv - Cancer Biology 2022Quote: ... All cell lines were regularly tested for mycoplasma contamination using a biochemical test kit (#LT07-318, Lonza, Switzerland) and were free of mycoplasma contamination.
-
bioRxiv - Cell Biology 2022Quote: ... 25 μg mRNA was transfected into 2.5 × 106 freshly thawed fibroblasts using Cell Line Nucleofector Kit V (Lonza) and AMAXA program X-001 following the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2022Quote: ... Transient transfections of these dominant-negative Rab11 a and siRab11 a into mouse MΦs (RAW 264.7 cell line) were performed with Amaxa mouse macrophage nucleofector kit (VPA-1009, Lonza) and DharmaFECT 4 Transfection Reagent (T-2004-01 ...
-
bioRxiv - Cell Biology 2022Quote: ... All cell lines were routinely tested for mycoplasma contamination by using the MycoAlert PLUS Mycoplasma Detection Kit (Lonza).
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... Cultures were confirmed to be free of mycoplasma infection using the MycoAlert Mycoplasma Detection Kit (Lonza, Walkersville, MD). Briefly ...
-
bioRxiv - Synthetic Biology 2024Quote: ... and Jurkat cell lines tested negative for mycoplasma with the MycoAlert Mycoplasma Detection Kit (Lonza Cat #LT07-318).
-
bioRxiv - Immunology 2023Quote: ... 1×10e6 cells per guide were electroporated with the corresponding RNP complex using Lonza Electroporation Kit V (Lonza). After 48 h ...
-
Vps18 contributes to phagosome membrane integrity in Mycobacterium tuberculosis-infected macrophagesbioRxiv - Microbiology 2023Quote: ... and nucleofection was performed as per the manufacturer’s recommendations (Lonza, SG Cell Line 4D-Nucleofector X Kit S). Monoclonal isolation of the knockouts were performed by limiting dilution ...
-
bioRxiv - Molecular Biology 2024Quote: ... iMEPM cells were tested for mycoplasma contamination using the MycoAlert Mycoplasma Detection Kit (Lonza Group Ltd, Basel, Switzerland). Packaged lentiviruses containing pLV[shRNA]-EGFP:T2A:Puro-U6>Scramble_shRNA (vectorID ...
-
bioRxiv - Neuroscience 2024Quote: ... we used the 4D-Nucleofector system and Amaxa P3 primary Cell 4D-Nucleofector X Kit S from Lonza. The electroporation buffer used was P3 primary cell Nucleofector Solution with Supplement 1 (Lonza) ...
-
bioRxiv - Cell Biology 2024Quote: ... containing the appropriate guide RNA (gRNA) sequences (CGCTCAACTCGGCCATGCGC; GCAACAGATGGAAGGCCTCC) using the AmaxaTM nucleofectorTM kit V (Lonza #VCA-1003). Monoclonal lines were screened for puromycin sensitivity ...
-
bioRxiv - Immunology 2024Quote: ... 1 - 2.5 × 106 Jurkat T cells were resuspended in EP buffer from the Nucleofector® Kit V (Lonza). Cells were combined with 1.5 μg of donor plasmid in a reaction volume of 100 μL and electroporated on the Amaxa® Nucleofector® II using pulse code X-005.
-
bioRxiv - Immunology 2024Quote: ... 16.4µl P3 and 3.6µl Supplement Reaction solutions from P3 Primary Cell 4D X Kit S (Lonza V4XP-3032) were added ...
-
bioRxiv - Biochemistry 2023Quote: ... Cell lines were tested once a month for mycoplasma contamination using Mycoalert® Detection Kit (Lonza, Basel, Switzerland). MCF7 and MDA-468 cells were grown in RPMI 1640 medium (Thermo Fisher Scientific ...
-
bioRxiv - Synthetic Biology 2023Quote: ... 1 × 106 HEK293T cells were transfected using SF Cell Line 4D-NucleofectorTM X Kit S (Lonza, V4XC-2012) with 7 µg of 5’ modified donor ...
-
bioRxiv - Molecular Biology 2024Quote: ... siRNA transfections were performed using the 4D-Nucleofector and the SE cell line 4D-Nucleofector X kits (Lonza) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2023Quote: ... Parasites and host cells were regularly tested for Mycoplasma contamination using the Mycoalert detection kit (Lonza; Basel, Switzerland). For all assays ...
-
bioRxiv - Molecular Biology 2023Quote: ... All cell lines were frequently tested for mycoplasma using MycoAlert Plus Mycoplasma Detection Kit (cat# LT07-218, Lonza).
-
bioRxiv - Cancer Biology 2022Quote: ... Cell lines were periodically tested to confirm Mycoplasma negativity using the MycoAlert mycoplasma Detection Kit (Lonza, Visp, Switzerland). Detailed methods for additional cell lines derived from solid tumors and leukemia are provided in Supplementary Materials and Methods.
-
bioRxiv - Immunology 2023Quote: Electroporation was performed to introduce siRNA into BMDCs using a mouse dendritic cell nucleofector kit (Lonza, Basel, Switzerland) and a Nucleofector 2b (Lonza) ...
-
bioRxiv - Molecular Biology 2023Quote: ... All cell lines were routinely tested for mycoplasma contamination by the MycoAlert Mycoplasma Detection Kit (Lonza #LT07-318).
-
bioRxiv - Immunology 2023Quote: ... The MPRA vector library was nucleofected into TPP macrophages (5µg vector into 5×106 cells) in 100μl nucleofection buffer (Human Macrophage Nucleofection Kit, Lonza) using a Nucleofector 2b (program Y-011) ...
-
bioRxiv - Developmental Biology 2023Quote: ... or pcDNA3.1(-) as a control using the AMAXA SG Cell line kit (4D-Nucleofector program EO-100; Lonza). Cells were further cultivated in DMEM/F12 supplemented with 10% FBS (Sigma ...
-
bioRxiv - Immunology 2023Quote: ... beads were removed on day 3 followed by electroporation using the Human T Cell Nucleofector™ Kit (Lonza) and the Amaxa Nucleofactor® 2b (Lonza ...
-
bioRxiv - Neuroscience 2023Quote: ... CRISPR reagents were transfected into iPSCs using the P3 Primary Cell 4D Nucleofector™ X Kit S (Lonza), as previously described (Deneault et al. ...
-
bioRxiv - Molecular Biology 2023Quote: ... and resuspended carefully in 20ul 4D-Nucleofector™ Solution (SE Cell Line 4D-Nucleofector™ X Kit, Lonza). Thereafter ...
-
A spatially resolved EGFR signaling model predicts the length scale of GAB1-SHP2 complex persistencebioRxiv - Systems Biology 2023Quote: ... Cells were confirmed to be mycoplasma-negative using the MycoAlert Mycoplasma Detection Kit (LT07-318; Lonza, Basel, Switzerland).
-
bioRxiv - Cancer Biology 2023Quote: ... All cell lines were tested negative for mycoplasma contamination with MycoAlert® Mycoplasma Detection Kit (Lonza, LT07-118).
-
bioRxiv - Cell Biology 2023Quote: ... dermal fibroblasts were expanded and verified mycoplasm negative via MycoAlert™ PLUS Mycoplasma Detection Kit (Lonza, 75860-362) infected with Sendai virus containing Yamanaka factors from the CytoTune™-iPS 2.0 Sendai Reprogramming Kit (ThermoFisher ...
-
bioRxiv - Cell Biology 2023Quote: ... All human cell lines were tested for Mycoplasma contamination using a MycoAlert Mycoplasma Detection Kit (Lonza, Basel, Switzerland).
-
bioRxiv - Cell Biology 2023Quote: PC12 cells were transfected with 300 nM siRNA by electroporation using the Cell Line Nucleofector Kit V (Lonza), following the manufacturer’s instructions ...
-
Hallmark molecular and pathological features of POLG disease are recapitulated in cerebral organoidsbioRxiv - Cell Biology 2023Quote: ... Regular monitoring for mycoplasma contamination was performed using the Myco Alert™ Mycoplasma Detection Kit (Lonza, #LT07-218) to ensure the integrity of the cell lines.
-
bioRxiv - Cell Biology 2024Quote: ... HeLa cells were electroporated using the Amaxa system with the nucleofection kit Cat No VCA-1003 from Lonza. Cells were FACS-sorted into 96-well plates to obtain single-cell derived colonies carrying the INDEL mutations ...
-
bioRxiv - Immunology 2024Quote: ... The P14 cell/Cas9/RNP mixes were transferred to Nucleofection cuvette strips (4D-Nucleofector X kit S; Lonza). Cells were electroporated using a 4D nucleofector (4D-Nucleofector Core Unit ...
-
bioRxiv - Cancer Biology 2024Quote: ... Absence of Mycoplasma contamination was determined at every plating using the MycoAlert kit according to manufacturer’s instructions (Lonza). Cell lines were cultured in 5% CO2 in a humidified atmosphere in 37°C ...
-
bioRxiv - Cancer Biology 2024Quote: ... Possible mycoplasma contamination was routinely monitored across all cell lines using the MycoAlert detection Kit (Lonza; LT07-318).
-
bioRxiv - Biochemistry 2024Quote: ... 3×105 cells were electroporated using P3 Primary Cell Nucleofector® 4D Kit and Nucleofector 4D system (Lonza) with 400 ng donor DNA ...
-
bioRxiv - Bioengineering 2024Quote: ... in a strip format using SF Cell Line 4D-Nucleofector™ X Kit S (Lonza, Cat# V4XC-2032). Purified PEs and CODEs were complexed with either pegRNA or cpegRNA to form RNP at 50 pmol protein ...