Labshake search
Citations for Lonza :
1051 - 1100 of 1160 citations for 4 Chloro 6 fluorobenzene 1 3 diamine since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2023Quote: Cell and organoid lines were generated from C3-TAg tumors (supplementary file 1) and tested for mycoplasma (Lonza, LT07-703) prior to use and the creation of frozen stocks ...
-
bioRxiv - Microbiology 2023Quote: ... Knock-down procedures were performed with siRNA purchased from Riboxx (non-targeting siRNA: UUGUACUACACAAAAGUACCCCC; US10 targeting #1: UUCUGAAUAACACAGCCGCCCCC) applying the SE Cell Line Kit (Lonza) for fibroblasts and Lipofectamine RNAiMax (Invitrogen ...
-
bioRxiv - Microbiology 2023Quote: ... Ribonucleoproteins were introduced into 1 x 106 sub-confluent BLaER1 cells using 4D-Nucleofector X Unit and SF Cell line Kit (Lonza), applying program DN-100 ...
-
bioRxiv - Physiology 2023Quote: ... 2 μl of KCNQ2/3 cDNA plasmid (0.9 g/l) and 1 μl of pmax green fluorescent protein vector (0.5 g/l) (Lonza, Cologne, Germany) were diluted in 125 μl of Opti-MEM medium (Life Technologies) ...
-
bioRxiv - Synthetic Biology 2023Quote: ... and 100 μL of YEA medium containing 1% (w/v) microwave-heated low-melting point agarose (SeaPlaque agarose, 50101; Lonza) was gently added to the central area ...
-
Cancer-associated fibroblasts produce matrix-bound vesicles that influence endothelial cell functionbioRxiv - Cancer Biology 2023Quote: ... HUVECs and HMVECs were cultured on 1% gelatin coated dishes in EGM-2 or EGM-2 MV (Lonza, Basel, Switzerland), respectively ...
-
bioRxiv - Cell Biology 2023Quote: ... were delivered as a ribonucleoprotein complex with the DNA donor template using a Nucleofector 2b Device and the Human Stem Cell Nucleofector Kit 1 (Lonza) following manufacturer’s instructions ...
-
bioRxiv - Genomics 2023Quote: ... of the PCR products were analyzed by electrophoresis on a 2% Agarose S gel (Nippon gene) in 1× TBE buffer and stained with GelStar (Lonza). The remaining PCR product of the condition that displayed a single-band or near single-band product on the gel was double size-selected and purified using AMPure XP beads (Beckman coulter ...
-
bioRxiv - Molecular Biology 2023Quote: ... 1×105 cells were grown in each well of 12 well culture plates in SkGM-2 BulletKit growth medium (Lonza) to >90% confluency under standard culture conditions of 37°C and 5% CO2 ...
-
bioRxiv - Neuroscience 2023Quote: ... and the ssODN (1 μl; stock 100 μM, IDT) in 20 μl of nucleofection buffer P3 (P3 Primary Cell NucleofectorTM Solution, Lonza) were nucleofected (program CA137 ...
-
bioRxiv - Neuroscience 2023Quote: ... reprogramming was initiated by nucleofection of 1×105 fibroblast with 1 µg of each episomal plasmid (pCXLE-hUL, pCXLE-hSK and pCXLE-hOCT4) using the Nucleofector 2b (Lonza). Initially ...
-
bioRxiv - Biophysics 2023Quote: ... MCF7 and A375 cells (ATCC) were transfected with 1 μg DNA using the SF Cell Line 4D-Nucleofector kit (Lonza) following the manufacturer’s instructions via electroporation (4D-Nucleofector ...
-
bioRxiv - Molecular Biology 2023Quote: ... MRTF-WT and MRTF knockout in NIH 3T3 (MRTF-KO-1 and MRTF-KO-2) cells were cultured in DMEM (BE12-614Q, Lonza) supplemented with 10 % Fetal Bovine Serum (FBS ...
-
bioRxiv - Molecular Biology 2023Quote: ... A cell count ranging from 1 × 10^5 to 2 × 10^5 cells was collected and suspended in 15 µL of nucleofection buffer (Lonza). Electroporations were conducted in the strip format ...
-
bioRxiv - Immunology 2023Quote: ... CTLs derived from LifeAct-GFP expressing pmel-1 mice were incubated with peptide-loaded and IFNγ-treated B16 cells cultured in phenol red-free DMEM (Lonza) supplemented with 10% FBS on stage at 37°C ...
-
bioRxiv - Developmental Biology 2023Quote: ... An mTmG lens carrying the MLR39-Cre allele was placed in a small hole in the center of an agarose pad that was prepared by loading 1 mL of 2% agarose (SeaKem GTG, Lonza) in M199 on the surface of 35 mm glass-bottom dish (3970-035 ...
-
bioRxiv - Cell Biology 2023Quote: ... and performed nucleofection where 1 × 106 of the selected clone were resuspended in 100 μl of P3 buffer (V4XP-3024, Lonza) containing 20 μg Alt-R® S.p ...
-
bioRxiv - Biochemistry 2024Quote: Agarose gel electrophoresis was run in horisontal mode using a home-built apparatus as described.39 All the samples and the gels (1% (w/v) Sea Kem LE Agarose from LONZA Bioscience ...
-
bioRxiv - Immunology 2024Quote: ... insert and placed in one well of a six-well plate in 1 ml serum free culture medium (“RB27”) composed of RPMI 1640 (Lonza), 4% B27 supplement (Thermo Fisher Scientific) ...
-
bioRxiv - Biophysics 2024Quote: ... or 5-twist alone) were isolated by the separation of nicked knot reactions in 1% low-melting point agarose gels (SeaPlaque agarose, Lonza), followed by excision of specific bands ...
-
bioRxiv - Neuroscience 2024Quote: ... 2 mg Cas9-gRNA-2 plasmid and 1 mg eGFP-puromycin resistance plasmid using the Amaxa 4D-Nucleofector system (Lonza) according to the manufacturer’s instructions with a pulse load of CA137 ...
-
bioRxiv - Genetics 2024Quote: One to two million cells from juvenile testes or two to three million cells from adult testes were embedded in plugs of 1% low-melting-point agarose (Lonza). After a brief incubation at 4 °C until the agarose became solid ...
-
bioRxiv - Immunology 2024Quote: ... 3µL of gRNA was mixed with 1µL electroporation enhancer (IDT 1075915) and 20µL of Jurkat T cells (1 x 105) in nucleofection solution (Lonza V4XC-1032). The mixture was transferred to a 16-well Nucleocuvette Strip and electroporated with the 4D-Nucleofector (Lonza ...
-
bioRxiv - Immunology 2024Quote: ... PBMC vials were thawed in the 37 °C water bath for 1-2 minutes and resuspended in warm X-VIVO 10 serum-free cell-media (Lonza). Samples were washed by centrifugation for 12 minutes at 1200 rpm at room temperature (RT) ...
-
bioRxiv - Genetics 2024Quote: ... T cells were centrifuged for 10 minutes at 90g and re-suspended in 1-2e6 T cells per 20 uL P3 Buffer (Lonza) and mixed with prepared Cas9 ribonucleoprotein (RNP ...
-
bioRxiv - Cancer Biology 2024Quote: ... with 2 μg pMito-iRFP670-FRB and 1 μg of the required GFP–FKBP (Ctrl or -Rab25) using programme A-23 (Lonza). The following day ...
-
bioRxiv - Cell Biology 2020Quote: BMDMs (1 × 106 cells) were transfected with siRNA (250 pmol) and Amaxa Mouse Macrophage Nucleofector Kit (Lonza, catalog number VPA-1009) using a Lonza Nucleofector 2b device (Lonza ...
-
bioRxiv - Genomics 2021Quote: ... Four aliquots of one million cells each per study subject were stimulated overnight for 12 hours in 1 ml X-VIVO™ 15 Serum-free Hematopoietic Cell Medium (Lonza) with 10 ul ImmunoCult™ Human CD3/CD28/CD2 T Cell Activator (STEMCELL Technologies) ...
-
bioRxiv - Immunology 2021Quote: ... The frequency of cells producing IFN-γ in responses to antigen was quantified with ELISpot (Diaclone; 2B Scientific, Oxon, U.K.) performed in HL-1 serum-free medium (BioWhittaker; Lonza, Slough, U.K.), supplemented with L-glutamine and penicillin–streptomycin (Life Technologies ...
-
bioRxiv - Plant Biology 2021Quote: ... pollen was collected immediately prior to bombardment and distributed on pollen germination medium solidified with 1% (w/v) NuSieve GTG Agarose (Lonza, Switzerland). Pollen germination media for Nicotiana (Wang and Jiang 2011 ...
-
bioRxiv - Biophysics 2020Quote: ... or in Binding buffer (1% w/v BSA and 25 mM HEPES pH 7.2 in DMEM without phenol red; Lonza Netherlands B.V.) at 4°C in the case of HeLa cells ...
-
bioRxiv - Genomics 2022Quote: ... 20 ng of HMW DNA was run on a 1% agarose gel (Seakem Gold Agarose, Lonza, Rockland, ME, USA, Cat #50150) in 0.5xTBE with the BioRad CHEF Mapper system (BioRad ...
-
bioRxiv - Microbiology 2021Quote: ... The Ala324Thr and the Glu655Asp mutations were independently recreated by transfecting the respective sgRNA template and donor dsDNA using the Basic Parasite Nucleofector™ Kit 1 (Lonza) with the U-033 program following manufacturer recommendations ...
-
bioRxiv - Neuroscience 2021Quote: ... supplemented with 10% of heat-inactivated fetal bovine serum (Biowest™) and 1% of antibiotics (penicillin + streptomycin, Lonza™ BioWhittaker™). One day after plating ...
-
bioRxiv - Immunology 2020Quote: ... The inoculum was then removed and replaced with 2 mL of complete DMEM medium with 1% SeaPlaque agarose (Lonza, Cat# 50100). The plate was incubated at 37°C and 5% CO2 for 3 days ...
-
bioRxiv - Genomics 2021Quote: ... K562 cells were grown to a density of 1×106 cells and electroporated with 5μg of plasmid DNA (Amaxa® Cell Line Nucleofector® Kit V, Lonza). Cells from each cell line were cultured for an additional 48 hours until total RNA isolation (Maxwell RSC simplyRNA kit ...
-
bioRxiv - Cell Biology 2020Quote: ... and DMEM with recommended Lonza supplements (1 supplement pack per 500 mL of media) with additional bovine pituitary extract (12.6 μg/mL, Lonza and AthenaES), BSA (final concentration of 1.5 μg/mL ...
-
bioRxiv - Cancer Biology 2021Quote: ... 100 ng/mL and 0.5 µg/mL or 1 µg/mL were used in Mammary Epithelial Growth Medium (Lonza, CC-3150), respectively ...
-
bioRxiv - Immunology 2020Quote: ... After washing cells were plated in 24-well tissue culture plate (0.5 × 106 /ml per well) in DMEM supplemented with 1% penicillin/streptomycin (Lonza #CC-4136), 10% FCS and 1% MEM non-essential amino acids solution (ThermoFisher ...
-
bioRxiv - Developmental Biology 2022Quote: ... 400,000 H9 cells for each condition were electroporated with 1 μg plasmid via a human stem cell nucleofector™ kit (VPH-5012) by Lonza AMAXA Nucleofector 2B.
-
bioRxiv - Bioengineering 2022Quote: ... Deep Blue was prepared at a ratio of 1:10 with colourless DMEM (without pyruvate, with 4.5 g/L glucose (Lonza, Basel, Switzerland)) and was added to each existing well and incubated at 37 °C for 3 h ...
-
bioRxiv - Physiology 2022Quote: ... (5 g/L trypsin and 2 g/L EDTA diluted 1 in 5 in calcium- and magnesium-free PBS) (Lonza, UK).
-
bioRxiv - Microbiology 2022Quote: ... NuLi-1 cells routinely tested negative for mycoplasma infection using MycoAlert Mycoplasma Detection Kit (LT07-418, Lonza Group AG, Basel, Switzerland) according to the manufacturer’s instructions.
-
bioRxiv - Cell Biology 2024Quote: ... and a control siRNA (D-001810-01-20 ON-TARGET plus Nontargeting siRNA #1) were prepared for electroporation using the Lonza SF Cell Line 4D-Nucleofector™ X Kit (V4XC-2012; Lonza) according to the manufacturer’s instruction with minor alterations ...
-
bioRxiv - Immunology 2023Quote: ... Cells enriched by Percoll density-dependent sedimentation were adjusted to a concentration of 1 × 106 cells/ml in serum-free X-VIVOTM 15 medium (Lonza BioWhittaker) containing 100 ng/ml recombinant human SCF (Peprotech ...
-
bioRxiv - Microbiology 2023Quote: ... 0.4 µg/ml hydrocortisone (Upjohn 100mg SERB), 0.5 µg/ml insulin (Novo Nordisk, Novorapid Flexpen) and 1× penicillin/streptomycin (LONZA, Verviers, Belgium). The flasks were incubated at 37°C with 5% CO2 in a humidified incubator ...
-
bioRxiv - Microbiology 2023Quote: ... Cells were co-incubated with virus and then supplemented with overlay medium that contains 1% SeaPlaque agarose (Lonza Bioscience, Basel, Switzerland). After 2 days of incubation ...
-
bioRxiv - Genomics 2023Quote: ... ATCC #CRM-CRL-1420) and PANC-1 cells (CVCL_0480, ATCC #CRM-CRL-1469) were cultured in D10 media: DMEM (Lonza #12-614Q) supplemented with 10% FBS (GELifeSciences #SH30071.03) ...
-
bioRxiv - Immunology 2023Quote: ... vectors was performed on day 2 of activation into 1×106 T cells using 4D-Nucleofector according to the manufacturer’s instructions (Lonza, Cologne, Germany).
-
bioRxiv - Immunology 2023Quote: ... Md) and cultured overnight at 37C culture at 378C with 5% CO2 in serum free HL-1 media (Lonza, Walkersville, Md) supplemented with Pen-Strep and 8 mmol/L Glutamax (Gibco ...