Labshake search
Citations for Lonza :
1051 - 1093 of 1093 citations for 3' Methyl 1 1' biphenyl 4 amine since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2020Quote: ... Cell line authenticity was confirmed by STR genotyping (July 2019) and mycoplasma testing was performed every 4-6 weeks (MycoAlert, Lonza).
-
bioRxiv - Cancer Biology 2022Quote: A small fragment (2-4 mm3) of tumor biopsies or surgically resected tumor was cultured in RPMI 1640 plus (Lonza) containing 10% FBS Hyclone (GE Healthcare) ...
-
bioRxiv - Microbiology 2022Quote: ... for 24 h then interleukin-2 (50U/ml) for 4-6 days before nucleofection (as recommended by the manufacturer, Lonza) or infection by HIV-1.
-
bioRxiv - Cell Biology 2021Quote: ... was generated by the introduction of a plasmid carrying the EGFP gene under the control of the CAG promoter to EStTA5-4 cells using the Amaxa Mouse ES cells Nucleofector Kit (VPH-1001, Lonza).
-
bioRxiv - Microbiology 2021Quote: ... Tightly synchronized schizonts were transfected using the Amaxa 4-D electroporator and P3 Primary Cell 4D Nucleofector X Kit L (Lonza) according to the protocol described by Moon et al ...
-
bioRxiv - Immunology 2020Quote: ... Cells were mixed with 5 μl of the RNP mixture by gently pipetting and were transferred to pre-cooled (4 °C) 16 well Nucleocuvette Strips (Lonza). Primary human B cells were nucleofected using the EH100 program of Lonza’s protocol ...
-
bioRxiv - Cell Biology 2021Quote: ... Western blots were conducted by running equivalent amounts of protein on 4-20% Tris-Glycine SDS/polyacrylamide gradient gels (Lonza) after reduction with 2-mercaptoethanol and heating to 95°C for 5m ...
-
bioRxiv - Developmental Biology 2020Quote: ... 4 μg of plasmid DNA was introduced to 4×106 neurons using an AMAXA nucleofection kit (VPG-1001, VPG-1003; Lonza). AMAXA-nucleofected cells were plated in 35mm glass bottom imaging dishes ...
-
bioRxiv - Neuroscience 2021Quote: ... the suspension was centrifuged (215g for 5min at 4°C) and the pellet was resuspended in BMEC-media that comprised of EBM-2 medium (Lonza) supplemented with the following ...
-
bioRxiv - Cell Biology 2022Quote: ... and 20 μg of the donor DNA using the Amaxa 4-D Nucleofactor X machine (Pulse code FP158) and P3 Primary Cell Kit (Lonza), according to protocols described by Moon et al ...
-
bioRxiv - Neuroscience 2024Quote: ... Four wells of EBs per line were seeded in a 4-layer cell discs coated with growth factor-reduced matrigel in X-VIVO15 medium (Lonza) supplied with GlutaMAX (Gibco) ...
-
bioRxiv - Molecular Biology 2023Quote: ... the paired RNPs were combined and nucleofected into 4×105 Raw 264-7 cells suspended in 10 ul of nucleofection buffer (Lonza) using the program DS-136 in a 4D Nucleofector X Unit (Lonza) ...
-
bioRxiv - Neuroscience 2024Quote: ... 500 pmol Cas12 crRNA (GGAAAAGTAAAAGATGTCTGAAT, IDT) and 20 μg recombinant Cas12 (IDT) using the P3 Primary Cell 4-D-Nucleofector kit (Lonza) and 4D-Nucleofector X unit (Lonza ...
-
bioRxiv - Systems Biology 2024Quote: ... 20 µL of cell suspension was then gently mixed with each crRNP and aliquoted into a 96-well electroporation cuvette for nucleofection with the 4-D Nucleofector X-Unit (Lonza) using pulse code EO-120 ...
-
bioRxiv - Pathology 2024Quote: Primary human lung fibroblasts from either IPF patients (n=4) or donors with no history of lung fibrosis (n=5) were purchased from Lonza at P2 (Supplementary Table 6) ...
-
bioRxiv - Immunology 2024Quote: ... A volume of 20 μL of cells was then transferred to the Nucleocuvette stripwell and electroporated with program DN-100 on a 4-D Nucleofector X unit (Lonza). Immediately after nucleofection ...
-
Synchronous 3D patterning of diverse CNS progenitors generates motor neurons of broad axial identitybioRxiv - Neuroscience 2024Quote: ... For the generation the ISL1 reporter line cells were nucleofected with pTG-Cr-ISL1 and pTG-HR-ISL1-p2A-mNeonGreen plasmids using a 4-D nucleofector system (AMAXA) and the P3 Primary Cell 4D-Nucleofector Kit (Lonza) following manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2024Quote: ... cells were seeded on the fibronectin-coated Petri dish (TPP) and kept in the incubator (37 °C and 5% CO2) for 4-8 h in the EGM-2 (Lonza) containing 2% FBS ...
-
bioRxiv - Molecular Biology 2021Quote: ... and Alt-R™ HDR donor oligo 5’ GTGTTTAGAAAAAAAAGAGTGTTTTTTTACCAGGGCCTTTGGCTCTTCCAGGAAGCAGATGTCCGAGTCGGAATATAATAACCCTTTCATACTCTTG 3’ (PS modification, antisense; IDT) using a 4D-nucleofector System X Unit (Lonza, Basel, Switzerland) and the P3 primary Cell 4D-Nucleofector® X kit (#V4XP-3024 ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: Five milligrams of niclosamide inhalation powder was loaded into size #3 hydroxypropyl methylcellulose capsules (Vcaps® plus, Capsugel®, Lonza, Morristown, NJ, USA). The aerodynamic properties of the powder were evaluated using a Next Generation Impactor (NGI ...
-
bioRxiv - Neuroscience 2022Quote: ... Harvested EBs were transferred to a tissue-culture treated 6-well plate (Falcon, #353224) in 3 ml of EB Differentiation media: X-VIVO 15 (Lonza Biosciences, #04-418Q) + 1% Glutamax (Life Technologies ...
-
bioRxiv - Cancer Biology 2024Quote: ... 1×106 T cells were transfected with Cas9/RNPs complexes of CD38 targeting guide RNA 5’-AGUGUAUGGGAUGCUUUCAA -3’ (Synthego) using Lonza 4D-Nucleofector™ X Unit (Lonza, AAF-1003X). Transfection was carried out in P3 Primary Cell 4D-Nucleofector™ Solution (Lonza ...
-
bioRxiv - Cell Biology 2021Quote: ... at a concentration of 10,000 units/l (penicillin) and 1 mg/l (streptomycin) and 2 mM L-glutamine (BioWhitaker, Lonza, 200 mM, cat. No. 17-605E), respectively ...
-
bioRxiv - Neuroscience 2021Quote: ... DRGs were then mechanically triturated and washed in a complete neurobasal A medium (NBA, Gibco® Invitrogen™ supplemented with 2% B27, 2mM L-glutamine and 1% antibiotics: penicillin + streptomycin, Lonza™ BioWhittaker™), before being plated in 35- mm petri dishes ...
-
bioRxiv - Neuroscience 2024Quote: ... A total of 0.5 µg per 106 of siRNA and 1 µg per 106 of DNA were transfected by Amaxa Nucleofector Technology using the Basic Nucleofector Kit (Lonza, Switzerland, EU, Cat# VPI-1001). After 18 h ...
-
bioRxiv - Molecular Biology 2021Quote: ... Cells were electroporated with enhancer (IDT, #1075915, final concentration 4 μM) in a nucleofector device (Lonza, Nucleofector 2; program D-032). Cells were incubated for 24 h to allow them to recover and then detached and cloned by serial dilution ...
-
bioRxiv - Immunology 2021Quote: ... Buffy coat cells were washed three times in 2.5 mM EDTA-PBS at 4°C before dilution and maintenance in RPMI-1640 supplemented with 10% FCS (PAA, AT or Lonza, CH) 2 mM glutamine ...
-
bioRxiv - Genomics 2021Quote: The MPRA libraries were electroporated in 4 to 6 million cells each using the Nucleofector 2b or 4D (Lonza, Basel, Switzerland) with 6 µg of plasmid DNA and program T-030 or Y-001 and DS-132 ...
-
bioRxiv - Physiology 2022Quote: ... 5 million cells were washed with phosphate buffered saline (PBS) and electroporated with 4-6 μg of appropriate plasmid construct using an Amaxa cell nucleofector (Lonza laboratories) and nucleofection reagent (362.88 mM ATP-disodium salt ...
-
bioRxiv - Neuroscience 2023Quote: ... Nucleofection was performed using the 4-D nucleofector system (AMAXA) and the P3 Primary Cell 4D-Nucleofector Kit (Lonza, V4XP-3024) following manufactures’ instructions (program CB-150) ...
-
bioRxiv - Cancer Biology 2024Quote: ... Cells were grown under sterile conditions for no longer than 4 weeks after thawing and were frequently tested for Mycoplasma using the MycoAlert® Assay kit (Lonza).
-
bioRxiv - Cell Biology 2024Quote: ... DCs derived from progenitor cells were transfected with 4 μg of DNA using the nucleofector kit for primary T cells (Amaxa, Lonza Group) following the manufacturer’s guidelines ...
-
bioRxiv - Genetics 2021Quote: Human embryonic microglia clone 3 (HMC3, ATCC® CRL3304™) cells were cultured in minimum essential medium (MEM) Eagle-EBSS with NEAA without L-Glutamine (Lonza, Cologne, Germany) supplemented with 10% fetal bovine serum (Sigma-Aldrich ...
-
bioRxiv - Cell Biology 2021Quote: ... and cells were isolated by centrifugation at 500 g for 5 min at 4°C followed by being treated with ACK Lysing Buffer (10-548E, Lonza Bioscience, Switzerland) to remove red blood cells ...
-
bioRxiv - Immunology 2020Quote: ... 106 cells per condition were nucleofected with 4 µg of DNA using the Amaxa Nucleofector II (Lonza, Kit R; program R-024). Nucleofected cells were allowed to recover for 24-48 hours before sorting for GFP positivity and lack of CD56 expression.
-
bioRxiv - Bioengineering 2024Quote: ... RNP’s and DNA were electroporated (EP) into T-cells in 16 well EP cuvettes on a 4-D Nucleofector X unit (Cat # V4XP-3032, Lonza, Walkersville, VA) using pulse code EH-115 ...
-
bioRxiv - Immunology 2022Quote: ... puromycin containing medium were changed and every 4 days cells were fed EGM™-2 Endothelial Cell Growth Medium-2 BulletKit™ (LONZA) supplemented with GlutaMax (ThermoFisher ...
-
bioRxiv - Neuroscience 2023Quote: ... Cells were electroporated at 5 million cells/100 mL cells per cuvette using a Lonza 4-D nucleofector with pulsecode DP-148 (Lonza, VVPA-1002). Cells were co-cultured for 5 additional days with human astrocyte before transferring cells to homeostatic culture conditions (MGdM media ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... droplets in 6 well plates and treated with retinoic acid for 4 days followed by hepatocyte growth media (Hepatocyte Culture Medium BulletKit (Lonza, CC-3198) supplemented with 10 ng/mL hepatocyte growth factor (PeproTech ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: About three milligrams of AUG-3387 mAb dry powder was loaded into size #3 hydroxypropyl methylcellulose (HPMC) capsules (Vcaps® plus, Capsugel®, Lonza, Morristown, NJ, USA). The aerodynamic properties of the powder were evaluated using a Next Generation Impactor (NGI ...
-
bioRxiv - Genomics 2022Quote: ... 1.0µg/µl SpCas9-sgRNA-PGK-Venus construct and 1µg/µl donor construct were nucleofected into ∼3×106 Tir1 mESCs using the Amaxa™ 4D-Nucleofector and the P3 Primary Cell 4D-Nucleofector™ X Kit (Lonza, Cat. V4XP-3024) following the manufacture’s protocol ...
-
bioRxiv - Cell Biology 2024Quote: All eight guide plasmids (4 for Sun1 and 4 for Sun2) were transfected into A549 cells using the Amaxa Cell Line Nucleofector Kit T (Lonza Bioscience, VCA-1002) according to the manufacturer’s instructions and plated into a 10cm plate in A549 media ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... 52 years-old; non-CF donor #2: WT-AB0834, male, 71 years-old; non-CF donor #4: CC-2540S-20TL256517, Lonza, female, 48 years-old). After co-incubation with correctors for 24 h in medium (MucilAir™ medium ...