Labshake search
Citations for Lonza :
1001 - 1050 of 1464 citations for 5 Bromo 2 Tert Butyldimethylsilyl 4 Methylthiazole since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2020Quote: ... Cell line authenticity was confirmed by STR genotyping (July 2019) and mycoplasma testing was performed every 4-6 weeks (MycoAlert, Lonza).
-
bioRxiv - Cell Biology 2021Quote: ... was generated by the introduction of a plasmid carrying the EGFP gene under the control of the CAG promoter to EStTA5-4 cells using the Amaxa Mouse ES cells Nucleofector Kit (VPH-1001, Lonza).
-
bioRxiv - Microbiology 2021Quote: ... Tightly synchronized schizonts were transfected using the Amaxa 4-D electroporator and P3 Primary Cell 4D Nucleofector X Kit L (Lonza) according to the protocol described by Moon et al ...
-
bioRxiv - Immunology 2020Quote: ... Cells were mixed with 5 μl of the RNP mixture by gently pipetting and were transferred to pre-cooled (4 °C) 16 well Nucleocuvette Strips (Lonza). Primary human B cells were nucleofected using the EH100 program of Lonza’s protocol ...
-
bioRxiv - Immunology 2021Quote: ... 2.106 T cells were resuspended in 20 µl of nucleofection solution with 3 µl or 4 µl RNP and transferred to Nucleofection cuvette strips (4D-Nucleofector X kit S; Lonza). Murine T cells were electroporated using the DN110 program of 4D nucleofector (4D-Nucleofector Core Unit ...
-
bioRxiv - Cell Biology 2021Quote: ... were isolated from healthy donors (n=3) as described[4] and seeded on 6 cm dishes within BEGM media (Lonza) before transduction with lentivirus (empty vector (Origene ...
-
bioRxiv - Cell Biology 2021Quote: ... Western blots were conducted by running equivalent amounts of protein on 4-20% Tris-Glycine SDS/polyacrylamide gradient gels (Lonza) after reduction with 2-mercaptoethanol and heating to 95°C for 5m ...
-
bioRxiv - Developmental Biology 2020Quote: ... 4 μg of plasmid DNA was introduced to 4×106 neurons using an AMAXA nucleofection kit (VPG-1001, VPG-1003; Lonza). AMAXA-nucleofected cells were plated in 35mm glass bottom imaging dishes ...
-
bioRxiv - Molecular Biology 2023Quote: ... the paired RNPs were combined and nucleofected into 4×105 Raw 264-7 cells suspended in 10 ul of nucleofection buffer (Lonza) using the program DS-136 in a 4D Nucleofector X Unit (Lonza) ...
-
bioRxiv - Cell Biology 2024Quote: ... Cells were passaged 1:10 every 3-4 days by trypsinisation and were regularly screened for mycoplasma contamination (Mycoalert, Lonza).
-
bioRxiv - Neuroscience 2024Quote: ... Four wells of EBs per line were seeded in a 4-layer cell discs coated with growth factor-reduced matrigel in X-VIVO15 medium (Lonza) supplied with GlutaMAX (Gibco) ...
-
bioRxiv - Cell Biology 2022Quote: ... and 20 μg of the donor DNA using the Amaxa 4-D Nucleofactor X machine (Pulse code FP158) and P3 Primary Cell Kit (Lonza), according to protocols described by Moon et al ...
-
bioRxiv - Immunology 2024Quote: ... A volume of 20 μL of cells was then transferred to the Nucleocuvette stripwell and electroporated with program DN-100 on a 4-D Nucleofector X unit (Lonza). Immediately after nucleofection ...
-
bioRxiv - Systems Biology 2024Quote: ... 20 µL of cell suspension was then gently mixed with each crRNP and aliquoted into a 96-well electroporation cuvette for nucleofection with the 4-D Nucleofector X-Unit (Lonza) using pulse code EO-120 ...
-
bioRxiv - Neuroscience 2024Quote: ... along with 20 μg recombinant Cas9 (IDT) and 1 pmol of each bridging oligonucleotide using the P3 Primary Cell 4-D-Nucleofector kit (Lonza) using the CA-137 program34 ...
-
bioRxiv - Neuroscience 2024Quote: ... 500 pmol Cas12 crRNA (GGAAAAGTAAAAGATGTCTGAAT, IDT) and 20 μg recombinant Cas12 (IDT) using the P3 Primary Cell 4-D-Nucleofector kit (Lonza) and 4D-Nucleofector X unit (Lonza ...
-
Synchronous 3D patterning of diverse CNS progenitors generates motor neurons of broad axial identitybioRxiv - Neuroscience 2024Quote: ... For the generation the ISL1 reporter line cells were nucleofected with pTG-Cr-ISL1 and pTG-HR-ISL1-p2A-mNeonGreen plasmids using a 4-D nucleofector system (AMAXA) and the P3 Primary Cell 4D-Nucleofector Kit (Lonza) following manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2020Quote: ... which were maintained using FGM-2 culture medium and protocols provided by the manufacturer (Lonza Inc.). For visualization purposes ...
-
bioRxiv - Cell Biology 2020Quote: ... cells were detached using TrypLE Express and co-cultured in EGM-2 media (Lonza# CC-3162) in different combinations for additional 60 hours as described in Supplemental Figure 8A-H.
-
bioRxiv - Cancer Biology 2020Quote: ... Primary human skeletal muscle myoblasts (HSMMs) were cultured in growth medium (SkGM-2 Bullet Kit, Lonza). HEK293T cells (kindly gifted by Slimane Ait-Si-Ali lab ...
-
bioRxiv - Cell Biology 2020Quote: Live cells plated on glass coverslips were fixed with 2% paraformaldehyde (Acros Organic) in PBS (Lonza) for 20 minutes at room temperature ...
-
bioRxiv - Immunology 2021Quote: ... NIH) in 100 µl IMDM/Glutamax/10% FBS containing 2× MycoZap Plus-PR (Lonza #VZA-2021), 100 ng/ml human IL-2 (GoldBio #1110-02-50) ...
-
bioRxiv - Bioengineering 2020Quote: ... ECs were suspended in EGM™-2 Endothelial Cell Growth Medium (Lonza,Basel, Switzerland CC-3162). Cells were cultured on 10 % matrigel coated microchannels and maintained in a humidified CO2 incubator at 37 °C and 5% CO2 ...
-
bioRxiv - Cell Biology 2021Quote: ... young adult worms were placed on a thin layer of 2% agarose (Lonza, SeaKem LE agarose) on a 24 × 55-mm coverslip (Matsunami) ...
-
bioRxiv - Cell Biology 2021Quote: ... Young adult worms were placed on a thin layer of 2% agarose (Lonza, SeaKem LE agarose) prepared on a 24 × 55-mm coverslip (Matsunami) ...
-
bioRxiv - Cell Biology 2021Quote: ... LECs were cultured using the EGM2-Endothelial cell growth medium-2 bullet kit (Lonza, Basel, Switzerland). Cells up to 6 passages were used in in vitro experiments ...
-
bioRxiv - Molecular Biology 2021Quote: ... at a confluence of 80-90% were incubated for 24 hours with EBM-2 medium (Lonza) containing 1% FBS (Gibco ...
-
bioRxiv - Cancer Biology 2020Quote: ... Endothelial cells (104 cells/well) were treated with compounds in fully supplemented EGM-2 medium (LONZA) for 48 h and then analyzed as above.
-
bioRxiv - Neuroscience 2023Quote: ... and the cell pellet resuspended in 2 ml of ACK lysing buffer (Lonza, Cat# 10-548E). After centrifugation ...
-
bioRxiv - Cell Biology 2023Quote: ... then the medium was replaced with hLSEC medium [EGM-2-MV microvascular endothelial cell medium (Lonza) supplemented with 50ng/mL recombinant human vascular endothelial growth factor-A (VEGF-A ...
-
bioRxiv - Immunology 2023Quote: ... with 0.05 mL blocking buffer (98% v/v FACS buffer (PBS + 2% v/v dFBS (Lonza)) and 2% v/v Fc receptor binding inhibitor (Thermo Fisher Scientific)) ...
-
bioRxiv - Immunology 2023Quote: ... 2 samples of 5x106 PBMCs were nucleofected in 100 mL of P3 buffer (Lonza; V4XP-3024) with 125 pmol of Alt-R Sp HiFi Cas 9 nuclease v3 (IDT ...
-
bioRxiv - Bioengineering 2024Quote: ... cells were treated with various concentrations of BMP-2 or FK506 in an osteogenic media (Lonza). Cell culture medium was changed every 3 days ...
-
bioRxiv - Bioengineering 2024Quote: ... they were treated with various concentrations of BMP-2 or FK506 in an osteogenic media (Lonza). The medium was replaced every 3-4 days ...
-
bioRxiv - Immunology 2024Quote: ... an electroporation reaction consisted of 2 × 105 HEK293T cells in 20 μL of SF buffer (Lonza) and 2 μL of 20 μM Cas9 RNP (equivalent to 40 pmol final concentration) ...
-
bioRxiv - Immunology 2024Quote: ... NIH) in 100 µL IMDM GlutaMAX/ 10% FBS containing 2× MycoZap Plus-PR (Lonza #VZA-2021), 100 ng/mL human IL-2 (GoldBio #1110-02-50) ...
-
bioRxiv - Cell Biology 2023Quote: ... cells were embedded in a YEA medium solidified with 2% low melting temperature agarose (Lonza, #50101) on a polylysine-coated glass bottom dish (Matsunami ...
-
bioRxiv - Immunology 2023Quote: ... MEFs were allowed to expand for 2-3 days before harvest with 0.05% trypsin-EDTA (Lonza). iBMDMs were immortalized with J2 virus to generate iBMDMs.
-
bioRxiv - Biophysics 2023Quote: The pellet of cells after electroporation was mixed with 2 % (w/w) SeaPrep agarose (Lonza, Switzerland) in DMEM at 37°C ...
-
bioRxiv - Bioengineering 2022Quote: ... as described before.[29] They were cultured in EBM™-2 basal medium (LONZA, CC-3156) that was supplemented with EGM™-2 SingleQuots™ supplements (LONZA ...
-
bioRxiv - Immunology 2023Quote: ... NIH) in 100 µl IMDM/Glutamax/ 10% FBS containing 2× MycoZap Plus-PR (Lonza #VZA-2021), 100 ng/ml human IL-2 (GoldBio #1110-02-50) ...
-
bioRxiv - Bioengineering 2024Quote: ... which directly correlates to cellular metabolic activity.58 LSEC cells were maintained in EBM-2 (Lonza) media with EGM-2 BulletKit (Lonza) ...
-
bioRxiv - Microbiology 2024Quote: Human colorectal adenocarcinoma cell line Caco-2 were maintained in Dulbecco’s Modified Eagle’s Media (DMEM) (Lonza) and supplemented with 10% FCS (Fetal calf serum ...
-
bioRxiv - Biophysics 2024Quote: ... Young adult worms were placed on a thin layer of 2% agarose (Lonza, SeaKem LE agarose) prepared on a 24 × 55-mm coverslip (Matsunami Glass ...
-
bioRxiv - Biochemistry 2024Quote: Human neuron cortical cells (HCN-2, ATCC, CRL-3592) were cultured in DMEM (Lonza, BE12-604F) supplemented with 4 mM L-glutamine (Biological Ind. ...
-
bioRxiv - Cell Biology 2021Quote: ... Human primary hepatic stellate cells from donors 3 and 4 were purchased as isolated hepatic stellate cells from Lonza (cat# HUCLS). Donor information is listed below.
-
bioRxiv - Immunology 2021Quote: ... Buffy coat cells were washed three times in 2.5 mM EDTA-PBS at 4°C before dilution and maintenance in RPMI-1640 supplemented with 10% FCS (PAA, AT or Lonza, CH) 2 mM glutamine ...
-
bioRxiv - Genomics 2021Quote: The MPRA libraries were electroporated in 4 to 6 million cells each using the Nucleofector 2b or 4D (Lonza, Basel, Switzerland) with 6 µg of plasmid DNA and program T-030 or Y-001 and DS-132 ...
-
bioRxiv - Physiology 2022Quote: ... 5 million cells were washed with phosphate buffered saline (PBS) and electroporated with 4-6 μg of appropriate plasmid construct using an Amaxa cell nucleofector (Lonza laboratories) and nucleofection reagent (362.88 mM ATP-disodium salt ...
-
bioRxiv - Neuroscience 2023Quote: ... Nucleofection was performed using the 4-D nucleofector system (AMAXA) and the P3 Primary Cell 4D-Nucleofector Kit (Lonza, V4XP-3024) following manufactures’ instructions (program CB-150) ...