Labshake search
Citations for Lonza :
51 - 100 of 1577 citations for R 4 5 Isopropylidene 2 pentanoic acid since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Bioengineering 2023Quote: ... 2×109 Freestyle CHO-S cells were resuspended in 500ml ProCHO 4 Protein-free Medium (Lonza, Cat#BEBP12-029 ...
-
bioRxiv - Bioengineering 2024Quote: ... were cultured for a maximum of 4 passages cultured in EGM™-2 (Lonza #CC-4176) in T-175 or T-75 culture flasks (Thermo ...
-
bioRxiv - Molecular Biology 2021Quote: ... and Alt-R™ HDR donor oligo 5’ GTGTTTAGAAAAAAAAGAGTGTTTTTTTACCAGGGCCTTTGGCTCTTCCAGGAAGCAGATGTCCGAGTCGGAATATAATAACCCTTTCATACTCTTG 3’ (PS modification, antisense; IDT) using a 4D-nucleofector System X Unit (Lonza, Basel, Switzerland) and the P3 primary Cell 4D-Nucleofector® X kit (#V4XP-3024 ...
-
bioRxiv - Bioengineering 2024Quote: ... with L-ascorbic acid-2-phosphate (AA2P) (5mg/ml stock, 10 µl/ml), and β-glycerolphosphate (BGP) (20 mM stock, 20 µl/ml) (Lonza). The cell culture medium was changed every 3 days ...
-
bioRxiv - Cell Biology 2020Quote: ... Nucleofector R T16 (Lonza, Gaithersburg, MD) was used to electroporate 5 x 106 IIA1.6 B Lymphoma cells with 2 μg of plasmid DNA ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... non-essential amino acids (Lonza), 10 percent heat-inactivated FBS (GE Healthcare Bio-Sciences) ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... non-essential amino acids (Lonza), and 10 percent heat-inactivated FBS (Hyclone) ...
-
bioRxiv - Immunology 2021Quote: ... 1% nonessential amino acids (Lonza), 1 mM sodium pyruvate (Gibco ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... non-essential amino acids (Lonza), and 10% heat-inactivated FBS (Hyclone).
-
bioRxiv - Microbiology 2020Quote: ... 1x nonessential amino acids (Lonza) and 20 µg ml-1 trypsin (Lonza) ...
-
bioRxiv - Immunology 2022Quote: ... amino acid (NEAA 100x Lonza) and Penicillin-Streptomycin (Gibco ...
-
bioRxiv - Physiology 2022Quote: ... ascorbic acid (CC-4116C, Lonza), bovine brain extract (CC-4092C ...
-
bioRxiv - Molecular Biology 2022Quote: ... ascorbic acid (#CC-4116C, Lonza), bovine brain extract (#CC-4092C ...
-
bioRxiv - Biochemistry 2023Quote: ... 1% 1xnonessential amino acids (Lonza), 50 μM 2-mercaptoethanol ...
-
bioRxiv - Cell Biology 2023Quote: ... non-essential amino acids (Lonza) and leukaemia inhibitory factor (1000 U/ml ...
-
bioRxiv - Cell Biology 2020Quote: ... expanded over 5-6 days of culture in EGM-2-medium (Lonza, CC-3156, CC-4176). Medium was aspirated and replaced by pre-warmed 10 mL serum-free EGM-2-medium per 10 cm/dish ...
-
bioRxiv - Immunology 2022Quote: Cryopreserved PBMC (2-5 × 106/sample) were thawed in prewarmed RPMI-1640 with L-glutamine (Lonza) + 10% FCS ...
-
bioRxiv - Cell Biology 2021Quote: ... 2 and 5 were isolated from human nonparenchymal liver cells (NPCs) purchased from Lonza (cat# HUCNP) as described previously (Chen et al. ...
-
bioRxiv - Cell Biology 2020Quote: ... expanded over 5-6 days of culture in EGM-2-medium (Lonza, CC-3156, CC-4176). Medium was aspirated and replaced by pre-warmed 10 mL serum-free EGM-2-medium per 10 cm/dish ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... Sf9 cells (4 × 105 cells* ml) in 2 ml of Insect-Xpress medium (Lonza, Walkersville, MD, USA) were transfected with recombinant bacmids using Cellfectin reagent (Life Technologies) ...
-
bioRxiv - Cell Biology 2022Quote: ... ∼2-4 million cells were electroporated using the T020 method of the Nucleofector™ 2b device (Lonza). Immediately after electroporation ...
-
bioRxiv - Biochemistry 2023Quote: ... ∼2-4 million cells were electroporated using the T020 method of the Nucleofector™ 2b device (Lonza). Immediately after electroporation ...
-
bioRxiv - Molecular Biology 2024Quote: ... Cells were harvested with trypsin, pelleted (500 g, 5 min, 4°C) and resuspended in PBS (pH 7.4) containing EDTA (Lonza) and 10% fetal bovine serum ...
-
bioRxiv - Biochemistry 2023Quote: ... Cells were harvested with trypsin, pelleted (500 g, 5 min, 4°C) and resuspended in PBS (pH 7.4) containing EDTA (Lonza) and 10% fetal bovine serum ...
-
bioRxiv - Bioengineering 2024Quote: ... The hUVEC cells were cultured and expanded until passage 5 with EGM-2 media (CC-3156, Lonza) and SingleQuot supplements (CC-4176 ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... Sf9 cells (4 x 105 cells*ml) in 2 ml of Insect-Xpress medium (Lonza; Cat#BE12-730P10) were transfected with recombinant bacmids using Cellfectin II reagent (Gibco-Thermo Fisher Scientific™ ...
-
bioRxiv - Bioengineering 2021Quote: ... and electroporated with 2-4pmol HDR template using a 4-D Nucleofector with pulse code CM-150 (Lonza). VLP/template mix was added to 15,000 cells in 50ul DMEM +10% FBS and 1x penicillin/streptomycin.
-
bioRxiv - Molecular Biology 2023Quote: ... ∼2-4 million cells were electroporated using the T-020 method of the Nucleofector™ 2b device (Lonza). Immediately after electroporation ...
-
bioRxiv - Biochemistry 2020Quote: ... Rat vascular SMCs (Lonza, R-ASM-580) were grown in DMEM with 20% FBS and 1x Antibiotic-Antimyotic (Thermo Fisher Scientific).
-
bioRxiv - Cell Biology 2023Quote: The Nucleofector R T16 (Lonza, Gaithersburg, MD) was used to electroporate 4 x 106 A20 B cells with 3 μg of plasmid DNA using the LC-013 program ...
-
bioRxiv - Physiology 2024Quote: Rat aortic SMCs (Lonza, #R-ASM-580) were cultured in 5% FBS-contained DMEM (10-013-CV ...
-
bioRxiv - Biochemistry 2020Quote: ... 1% non-essential amino acids (Lonza) and 2 mM L-glutamine ...
-
bioRxiv - Microbiology 2020Quote: ... 1X non-essential amino acids (Lonza), 1mM sodium pyruvate (Gibco) ...
-
bioRxiv - Microbiology 2020Quote: ... non-essential amino acids (1X, Lonza), penicillin (100 IU/mL ...
-
bioRxiv - Microbiology 2022Quote: ... non-essential amino acids (1×, Lonza), penicillin (100 IU/mL) ...
-
bioRxiv - Microbiology 2020Quote: ... and 1x nonessential amino acids (Lonza) and 20 μg/ml N-tosyl-l-phenylalanine chloromethyl ketone (TPCK ...
-
bioRxiv - Microbiology 2020Quote: ... and 1x nonessential amino acids (Lonza). Vero-118 cells were cultured in Iscove’s Modified Dulbecco’s Medium (IMDM ...
-
bioRxiv - Microbiology 2020Quote: ... and 1x nonessential amino acids (Lonza).
-
Bipartite viral RNA genome heterodimerization influences genome packaging and virion thermostabilitybioRxiv - Molecular Biology 2022Quote: ... 1 × nucleic acid stain (GelStar, Lonza) was added to a 96 well qRT-PCR plate ...
-
bioRxiv - Genomics 2022Quote: ... 1X non-essential amino acids (Lonza), 1X Glutamax ...
-
bioRxiv - Bioengineering 2023Quote: ... 1% non-essential amino acids (Lonza), 2mM L-glutamine (200mM ...
-
bioRxiv - Cell Biology 2024Quote: ... 1% Non-Essential Amino Acids (Lonza), 1% DMSO (PanBiotech ...
-
bioRxiv - Genetics 2020Quote: ... ∼1×106 cells were transfected with pairs of 5 µg gRNA plasmid and 4 µg ssODN (Supplementary Table 3) using AmaxaTM Human CD34 Cell NucleofectorTM Kit (Lonza) in the 2B-NucleofectorTM on the U-08 setting ...
-
bioRxiv - Pathology 2024Quote: Primary human lung fibroblasts from either IPF patients (n=4) or donors with no history of lung fibrosis (n=5) were purchased from Lonza at P2 (Supplementary Table 6) ...
-
bioRxiv - Genetics 2020Quote: ... 20 µg ssODNs and 4 µg pSpCas9(BB)-2A-GFP construct using Human Stem Cell Nucleofector Kit 2 (Lonza). For the generation of UE-RASGEF1A-int1-KO and PIK3C2B-int10-KO hPSC lines ...
-
bioRxiv - Cell Biology 2020Quote: ... U–2–OS-pEP15 cells (5) were maintained in 1 mg/ml glucose phenol-red-free DMEM (Lonza) supplemented with steroid-free FBS (Thermo Fisher Scientific) ...
-
bioRxiv - Physiology 2023Quote: ... USA) were cultured in 5% fetal bovine serum containing endothelial cell growth medium (EGM-2; Lonza, Basel, Switzerland). Media was supplemented with heparin ...
-
bioRxiv - Biophysics 2021Quote: ... 0.1 mM non-essential amino acids (Lonza), 1 mM sodium pyruvate (Life technologies ...
-
bioRxiv - Immunology 2021Quote: ... 100 μM non-essential amino acids (Lonza), 1 mM sodium pyruvate (VWR) ...
-
bioRxiv - Biophysics 2020Quote: ... 0.1 mM non-essential amino acids (Lonza), 1 mM sodium pyruvate (Life technologies ...