Labshake search
Citations for Lonza :
51 - 100 of 1434 citations for Human integrin alpha 5 beta 3 His tag since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2021Quote: ... Human primary hepatic stellate cells from donors 3 and 4 were purchased as isolated hepatic stellate cells from Lonza (cat# HUCLS). Donor information is listed below.
-
bioRxiv - Immunology 2022Quote: ... were transfected with 0.1 nmol of siRNA oligonucleotides (listed in Supplementary Table 3) using a Human Monocyte Nucleofactor Kit (Lonza, VVPA-1007) and the AMAXA Nucleofector System (Lonza ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... and PX458-AAVS1 (3 µg) were electroporated into 1.3×106 H9 cells using the Human Stem Cell Nucleofector Kit 1 (Lonza, VPH-5012). Following electroporation the cells were seeded across 3-wells of a 6 well plate coated with Matrigel in StemFlex supplemented with RevitaCell supplement (Thermo Fisher ...
-
bioRxiv - Immunology 2024Quote: ... were transfected with 0.1 nmol of siRNA oligonucleotides (listed in Extended Data Table 3) using a Human Monocyte Nucleofactor Kit (Lonza, VVPA-1007) and the AMAXA Nucleofector System (Lonza ...
-
bioRxiv - Genetics 2019Quote: PBT cells were transfected with 5 μg DNA for 5.106 cells in 100 μl of Human T Cell Nucleofector Solution (Lonza) with the program U-014 (Amaxa Biosystems).
-
bioRxiv - Biochemistry 2024Quote: Human HeLa cells (ATCC) were grown at 37°C in 5% CO2 using Dulbecco’s Modified Eagle Medium (Lonza, USA) supplemented with 10% FBS superior (Biochrom ...
-
bioRxiv - Immunology 2023Quote: ... Cas9-gRNA ribonucleoproteins were assembled as described previously53 and nucleofected into 5×106 monocytes in 100μL nucleofection buffer (Human Monocyte Nucleofection Kit, Lonza) using a Nucleofector 2b (Lonza ...
-
bioRxiv - Bioengineering 2023Quote: Primary human alveolar epithelial cells (HPAECs, CellBiologics) were cultured at 37°C and 5% CO2 with SABM medium (Lonza), SAGM supplements (Lonza) ...
-
bioRxiv - Cancer Biology 2019Quote: ... 5 × 106 cells were co-transfected with 5 μg of pSpCas9(BB)– 2A–Puro:sgRNA #4 plasmid and 5 μg of pCSII–CMV:A3B–3×FLAG–IRES–EGFP donor DNA plasmid using the Amaxa Nucleofector (Lonza) with nucleofection solution R ...
-
bioRxiv - Cell Biology 2021Quote: ... siRNA directed against Dsg1 (Integrated DNA Technologies) with a targeting sequence 5′-CCATTAGAGAGTGGCAATAGGATGA-3′ using Amaxa Nucleofector System (Lonza) for electroporation of cells according to manufacturer’s instructions.
-
bioRxiv - Neuroscience 2024Quote: ... and 300μM single stranded oligodeoxynucleotides (ssODN: 5’gggtccagggtggctgtcactcat ccttttttctggctaccaaaggtgcagataattaaGaagaagctggatcttagcaacgtccagccaagtgtggctcaaaggataatatc aaacacgtcc 3’) and the P3 Primary Cell 4D reaction mix (Lonza). We screened a minimum of 96 clones for genetic editing ...
-
bioRxiv - Genomics 2022Quote: Human primary proximal tubular cells (human RPTEC, Lonza; CC-2553) were cultured with renal epithelial cell growth medium kit (Lonza ...
-
bioRxiv - Genomics 2021Quote: ... Human primary proximal tubular cells (human RPTEC, Lonza; CC-2553) were cultured with renal epithelial cell growth medium kit (Lonza ...
-
bioRxiv - Bioengineering 2022Quote: Human (Lonza, HUM4198) and rhesus macaque (Lonza ...
-
bioRxiv - Developmental Biology 2023Quote: iPSCs were transfected with sgRNA 3’ UCCCUUUCCUCAGGUCACAG 5’ (Synthego) via nucleofection using program CA137 on a 4D Nucleofactor X (Lonza) as per manufacturer’s instructions ...
-
bioRxiv - Genomics 2024Quote: Human primary proximal tubular cells (human primary PTC, Lonza; CC-2553) were cultured with renal epithelial cell growth medium kit (Lonza ...
-
bioRxiv - Genomics 2024Quote: Human primary proximal tubular cells (human primary PTC, Lonza; CC-2553) were cultured with renal epithelial cell growth medium kit (Lonza ...
-
bioRxiv - Developmental Biology 2020Quote: ... about 8 × 105 iPSCs were transfected with 5 μg of plasmids with Lonza Human Stem Cell Nucleofector Kit 1 (Lonza, VPH-5012) on a Nucleofector 2b device (Lonza ...
-
bioRxiv - Cell Biology 2021Quote: ... 5 µg of sgRNA and 5 µg of ssDNA donor template (Table S1) using Human Stem Cell NucleofectorTM kit 1 (Lonza, VVPH-5012) according to the manufactures protocol and cells replated ...
-
bioRxiv - Microbiology 2024Quote: ... 5 million parasites were electroporated with 5-10ug of digested plasmid with an AMAXA Nucleofector II using X-001 in Human T-cell Nucleofector Solution (Lonza VPA-1002).
-
bioRxiv - Molecular Biology 2023Quote: Induced pluripotent stem cells were transfected with a total of 5 μg target Cas9/gRNA plasmids with or without 1 μg repair templates using Human Stem Cell Nucleofector Kit (LONZA, Basel, Switzerland) and Nucleofector 2b device (LONZA ...
-
bioRxiv - Cell Biology 2022Quote: ... Primary human melanocytes (Normal Human Epidermal Melanocytes, NHEM) were obtained from Lonza. All cell culture reagents were obtained from GIBCO Life technologies ...
-
bioRxiv - Bioengineering 2021Quote: Human MSCs were isolated from fresh bone marrow from human donors (Lonza, male 23 years ...
-
bioRxiv - Molecular Biology 2022Quote: Human primary EC(Lonza) were cultured in complete endothelial basal medium (EBM ...
-
bioRxiv - Bioengineering 2019Quote: Human dermal fibroblasts (Lonza) were expanded at 2000 cells/cm2 in DMEM+Glutamax medium (Thermo Fisher Scientific ...
-
bioRxiv - Cancer Biology 2019Quote: ... Human neonatal keratinocytes (Lonza) were grown according to manufacturer’s recommendations ...
-
bioRxiv - Physiology 2020Quote: ... Normal human astrocytes (Lonza) were cultured in astocytic basal medium (ABM ...
-
bioRxiv - Neuroscience 2022Quote: Primary human astrocytes (Lonza) were maintained in a complete astrocyte growth medium (ScienCell ...
-
bioRxiv - Neuroscience 2022Quote: Primary human astrocytes (Lonza) were maintained in complete astrocyte growth medium (ScienCell ...
-
bioRxiv - Neuroscience 2024Quote: Primary human astrocytes (Lonza) were cultured in a complete astrocyte growth medium (ScienCell ...
-
bioRxiv - Neuroscience 2024Quote: Fetal human astrocytes (Lonza) were cultured in Astrocyte Media (ScienCell ...
-
bioRxiv - Bioengineering 2023Quote: Human BMSC (Lonza, 19TL155677) were thawed and plated at 6000 cells/cm2 in an expansion culture medium containing a basal alpha minimum essential medium (α-MEM,22571) ...
-
bioRxiv - Developmental Biology 2023Quote: Human aortic SMCs (Lonza) were cultured up to passage 6 in M199 medium supplemented with 10% FBS and growth factors (PeproTech ...
-
bioRxiv - Bioengineering 2023Quote: ... Human lung fibroblasts (Lonza) at passage 7 were maintained in FibroLife S2 Fibroblast Medium (Lifeline Cell Technology ...
-
bioRxiv - Microbiology 2023Quote: ... plates were incubated at 37°C for 30 minutes in blocking buffer (PBS with 1% BSA, 5% FBS, and 1% human AB serum (Lonza, Walkersville, MD, USA), washed three times in PBS with 0.05% tween 20 and incubated with a commercial anti-SARS-CoV-2 Spike antibody (1/1000 ...
-
bioRxiv - Bioengineering 2022Quote: ... GM-3TM Lymphocyte Growth Medium-3 (LGM-3™) (Lonza), Opti-MEM Serum-Free medium (Thermofisher) ...
-
bioRxiv - Developmental Biology 2021Quote: ... and 5 µg of PX459 gRNA vector (5’-GACTCCAGTCTTTCTAGAAGA-3’) were nucleofected with the AMAXA Mouse Embryonic Stem Cell Nucleofector Kit (LONZA, VPH-100) using program A-30 in the XRep ...
-
bioRxiv - Bioengineering 2023Quote: Cells were cultured at 37°C and 5% CO2 in cell-specific media: primary human umbilical vascular endothelial cells (HUVECs, Lonza; up to passage 6) in EGM-2 (Lonza ...
-
bioRxiv - Bioengineering 2020Quote: Human MSCs (hMSCs) were isolated from fresh unprocessed bone marrow from human donors (Lonza) as previously described 63 ...
-
bioRxiv - Molecular Biology 2021Quote: ... and Alt-R™ HDR donor oligo 5’ GTGTTTAGAAAAAAAAGAGTGTTTTTTTACCAGGGCCTTTGGCTCTTCCAGGAAGCAGATGTCCGAGTCGGAATATAATAACCCTTTCATACTCTTG 3’ (PS modification, antisense; IDT) using a 4D-nucleofector System X Unit (Lonza, Basel, Switzerland) and the P3 primary Cell 4D-Nucleofector® X kit (#V4XP-3024 ...
-
bioRxiv - Cancer Biology 2024Quote: ... 1×106 T cells were transfected with Cas9/RNPs complexes of CD38 targeting guide RNA 5’-AGUGUAUGGGAUGCUUUCAA -3’ (Synthego) using Lonza 4D-Nucleofector™ X Unit (Lonza, AAF-1003X). Transfection was carried out in P3 Primary Cell 4D-Nucleofector™ Solution (Lonza ...
-
bioRxiv - Immunology 2021Quote: Human normal dendritic cells (Lonza) were cultured in 50 ng/ml GM-CSF and 50 ng/ml IL-4 for 5 days ...
-
bioRxiv - Bioengineering 2021Quote: Cryopreserved primary human hepatocytes (Lonza) were thawed according to manufacturer’s protocol and the cells were directly used in experiments ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: Normal human lung fibroblasts (Lonza) and Primary Human IPF Lung Parenchymal Fibroblasts (Donor2 ...
-
bioRxiv - Bioengineering 2019Quote: ... Human BM CD34+ cells (Lonza) were expanded for 5 days in Stemline II (Sigma-Aldrich ...
-
bioRxiv - Cell Biology 2020Quote: ... Normal human astrocytes (NHA)(Lonza) were thawed at P5 and cultured for 5-10 days prior to cell seeding ...
-
bioRxiv - Bioengineering 2024Quote: ... and recombinant human insulin 0.5%) (Lonza). Human cervical cancer cell line SiHa from ATCC (ATCC® HTB-35™ ...
-
bioRxiv - Biophysics 2024Quote: Human umbilical vein ECs (Lonza) were cultured using standard protocols in Endothelial Growth Medium (EGM2 ...
-
bioRxiv - Microbiology 2024Quote: ... normal human bronchial epithelial (Lonza), and porcine primary nasal epithelial (24 ...
-
bioRxiv - Bioengineering 2023Quote: Human bone marrow aspirates (Lonza) were purchased to isolate primary hMSCs ...