Labshake search
Citations for Lonza :
51 - 82 of 82 citations for H D Glu amc oh since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Developmental Biology 2024Quote: ... Inducible lines were generated by treating the recipient 2lox.Cre ESCs36,39 for 16 h with DOX (1μg/mL) to induce Cre recombinase expression followed by nucleofection (Lonza, VPG-1004) of the p2Lox-FlagB plasmids containing the desired construct ...
-
bioRxiv - Cell Biology 2024Quote: ... cells were seeded on the fibronectin-coated Petri dish (TPP) and kept in the incubator (37 °C and 5% CO2) for 4-8 h in the EGM-2 (Lonza) containing 2% FBS ...
-
bioRxiv - Cancer Biology 2024Quote: ... into A2780 DExCon-modified NBGFP-mCherry-Rab25 cells (pre-treated with dox >94 h; 250 ng/ml) by using an Amaxa Nucleofector II Electroporation machine (Lonza) on program A-023 ...
-
bioRxiv - Cell Biology 2021Quote: ... at 0.1-1 μg/mL or as a control a GFP plasmid (PmaxGFP, Lonza, Cat. No. D-00059) using Lipofectamine 3000 (Invitrogen ...
-
bioRxiv - Bioengineering 2021Quote: ... and electroporated with 2-4pmol HDR template using a 4-D Nucleofector with pulse code CM-150 (Lonza). VLP/template mix was added to 15,000 cells in 50ul DMEM +10% FBS and 1x penicillin/streptomycin.
-
bioRxiv - Genomics 2020Quote: ... that were then electroporated using a Lonza 4-D Nucleofector with 96-well Shuttle™ add-on (Lonza). Sequences of sgRNA can be found in Supplementary Table 2 ...
-
bioRxiv - Molecular Biology 2020Quote: HEK293 cells were passaged in poly-D-Lysine treated plates and incubated overnight in OPTI-MEM medium (Lonza) at 37°C ...
-
bioRxiv - Cell Biology 2024Quote: ... STD-M (−) consisted of Dulbecco’s Modified Eagles Medium 4.5 g/L D-glucose (DMEM; Lonza, Walkersville, MD, USA) supplemented with 50 U/mL penicillin (Thermo Fisher Scientific ...
-
bioRxiv - Immunology 2021Quote: ... The infected cells were incubated for 72 h in Dulbecco’s Modified Eagle Medium with L-glutamine (DMEM; Lonza, Walkersville, MD, USA) containing 2% heat-inactivated fetal bovine serum (FBS ...
-
bioRxiv - Bioengineering 2022Quote: ... for 1.5 h at 37°C and 5% CO2 before seeded with human umbilical vein endothelial cells (HUVECs, pooled donor, Lonza, Switzerland). Endothelial Cell Growth Medium-2 (EGM-2 ...
-
bioRxiv - Genomics 2024Quote: Transfection– K562-based CRISPR cell lines were nucleofected with 500 ng sgRNA plasmid DNA using 4-D nucleofector X Unit with 16-well nucleocuvette strips according to the manufacturer’s instructions (Lonza). For Casilio-i perturbations ...
-
bioRxiv - Cell Biology 2020Quote: ... cell monolayers were washed twice in sterile D-PBS and cells were detached with Trypsin 0.5 g/L EDTA 0.2 g/L (Lonza, # BE17-161E) for 5 minutes ...
-
bioRxiv - Microbiology 2020Quote: ... 20 µL of cell suspension was then gently mixed with each crRNP and aliquoted into a 96-well electroporation cuvette for nucleofection with the 4-D Nucleofector X-Unit (Lonza) using pulse code EO-120 ...
-
bioRxiv - Microbiology 2021Quote: ... Tightly synchronized schizonts were transfected using the Amaxa 4-D electroporator and P3 Primary Cell 4D Nucleofector X Kit L (Lonza) according to the protocol described by Moon et al ...
-
bioRxiv - Cell Biology 2020Quote: ... HMVECs-D were cultured in endothelial basal medium-2 (EBM-2) supplemented with EGM™-2 MV BulletKits™ (Lonza). Cell from passage 3 to passage 6 were used ...
-
bioRxiv - Cell Biology 2022Quote: ... and 20 μg of the donor DNA using the Amaxa 4-D Nucleofactor X machine (Pulse code FP158) and P3 Primary Cell Kit (Lonza), according to protocols described by Moon et al ...
-
bioRxiv - Molecular Biology 2022Quote: ... D-PBS was gently aspirated from the T cell pellet and then resuspended in 15 μL of buffer P3 (Lonza). The cell suspension was then transferred to the RNP mix and thoroughly triturated ...
-
bioRxiv - Neuroscience 2024Quote: ... along with 20 μg recombinant Cas9 (IDT) and 1 pmol of each bridging oligonucleotide using the P3 Primary Cell 4-D-Nucleofector kit (Lonza) using the CA-137 program34 ...
-
bioRxiv - Neuroscience 2024Quote: ... 500 pmol Cas12 crRNA (GGAAAAGTAAAAGATGTCTGAAT, IDT) and 20 μg recombinant Cas12 (IDT) using the P3 Primary Cell 4-D-Nucleofector kit (Lonza) and 4D-Nucleofector X unit (Lonza ...
-
bioRxiv - Systems Biology 2024Quote: ... 20 µL of cell suspension was then gently mixed with each crRNP and aliquoted into a 96-well electroporation cuvette for nucleofection with the 4-D Nucleofector X-Unit (Lonza) using pulse code EO-120 ...
-
bioRxiv - Immunology 2024Quote: ... A volume of 20 μL of cells was then transferred to the Nucleocuvette stripwell and electroporated with program DN-100 on a 4-D Nucleofector X unit (Lonza). Immediately after nucleofection ...
-
Synchronous 3D patterning of diverse CNS progenitors generates motor neurons of broad axial identitybioRxiv - Neuroscience 2024Quote: ... For the generation the ISL1 reporter line cells were nucleofected with pTG-Cr-ISL1 and pTG-HR-ISL1-p2A-mNeonGreen plasmids using a 4-D nucleofector system (AMAXA) and the P3 Primary Cell 4D-Nucleofector Kit (Lonza) following manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2024Quote: PC-3 cells (1 × 106 cells) were transfected with 2 μg of mGFP-GPI cDNA using a 4-D nucleofector (LONZA) and cultured in two 150-mm dishes until reaching approximately 100% confluence (2 × 107 cells) ...
-
bioRxiv - Cell Biology 2020Quote: ... cells were serum starved for at least 13 h in 1% FBS (Atlanta Bio selected, Cat #S11110) or without FBS using endothelial cells growth basal medium (Lonza cat#cc-3121) instead of MCDB-131-complete media ...
-
bioRxiv - Cell Biology 2023Quote: ... cultured for 48 h at 37°C with 5% CO2 in EGM™-2 Endothelial Cell Growth Medium-2 BulletKit™ (Lonza, UK) with penicillin–streptomycin (100_U/ml ...
-
bioRxiv - Cell Biology 2023Quote: ... cultured for 48 h at 37°C with 5% CO2 in EGM™-2 Endothelial Cell Growth Medium-2 BulletKit™ (Lonza, UK) with penicillin–streptomycin (100_U/ml ...
-
bioRxiv - Molecular Biology 2021Quote: ... Cells were electroporated with enhancer (IDT, #1075915, final concentration 4 μM) in a nucleofector device (Lonza, Nucleofector 2; program D-032). Cells were incubated for 24 h to allow them to recover and then detached and cloned by serial dilution ...
-
bioRxiv - Neuroscience 2023Quote: ... Nucleofection was performed using the 4-D nucleofector system (AMAXA) and the P3 Primary Cell 4D-Nucleofector Kit (Lonza, V4XP-3024) following manufactures’ instructions (program CB-150) ...
-
bioRxiv - Biochemistry 2024Quote: ... and 50 mM D-mannitol] modified from a previous report,86 and electroporation was performed by a Nucleofector 2b device (Lonza Bioscience). Cells were transfected with siRNAs twice with a 48-h interval ...
-
bioRxiv - Bioengineering 2024Quote: ... RNP’s and DNA were electroporated (EP) into T-cells in 16 well EP cuvettes on a 4-D Nucleofector X unit (Cat # V4XP-3032, Lonza, Walkersville, VA) using pulse code EH-115 ...
-
bioRxiv - Neuroscience 2023Quote: ... Cells were electroporated at 5 million cells/100 mL cells per cuvette using a Lonza 4-D nucleofector with pulsecode DP-148 (Lonza, VVPA-1002). Cells were co-cultured for 5 additional days with human astrocyte before transferring cells to homeostatic culture conditions (MGdM media ...
-
bioRxiv - Cell Biology 2024Quote: Human Umbilical Vein Endothelial Cells (HUVEC-h-TERT2 – Evercyte CHT-006-0008) were cultured in Endothelial Cell Growth Medium (Lonza EGM BulletKit CC-3121 & CC-4133) supplemented with the growth factors provided in the kit ...