Labshake search
Citations for Lonza :
51 - 100 of 1599 citations for Cyclohexyl 2 3 4 5 trifluorophenyl ethyl ketone since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2021Quote: ... coated dishes (5 ng/cm2) and cultured in Endothelial Growth Medium 2 (EGM2, Lonza) supplemented with 50 ng/mL VEGF with medium changes every other day until they reached confluency ...
-
bioRxiv - Bioengineering 2024Quote: ... were cultured on a 0.1% gelatin-coated tissue culture dish at 37°C and 5% CO2 in Endothelial Cell Growth Medium - 2(EGM-2, Lonza, Basel, CH). HUVECs were transduced with mCherry lentiviral pseudovirus (pCDH-CMV-mCherry-T2A-Puro ...
-
bioRxiv - Neuroscience 2021Quote: ... Tissues were washed 3-4 times over 1 hour in PBS (calcium- and magnesium-free; Lonza BioWhittaker #17-517Q) containing 0.1% Triton X-100 (PBT ...
-
bioRxiv - Cancer Biology 2023Quote: ... Regular testing for mycoplasma contamination was conducted every 3-4 weeks using the MycoAlert PLUS mycoplasma detection kit (Lonza).
-
bioRxiv - Cell Biology 2021Quote: ... Passaging of iPSCs was carried out every 4-5 days using Versene (EDTA 0.02%) (Lonza, BE17–771E) solution for 3–5⍰minutes at 37⍰°C ...
-
bioRxiv - Cell Biology 2023Quote: ... cultured for 48 h at 37°C with 5% CO2 in EGM™-2 Endothelial Cell Growth Medium-2 BulletKit™ (Lonza, UK) with penicillin–streptomycin (100_U/ml ...
-
bioRxiv - Cell Biology 2023Quote: ... cultured for 48 h at 37°C with 5% CO2 in EGM™-2 Endothelial Cell Growth Medium-2 BulletKit™ (Lonza, UK) with penicillin–streptomycin (100_U/ml ...
-
bioRxiv - Cell Biology 2024Quote: ... The cells were used from passages 5-9 for the experiments and were cultured in endothelial cell growth Medium-2 (EGM™-2) Bulletkit™ (Lonza Bioscience) on pretreated tissue culture 6-well plate (VWR international) ...
-
bioRxiv - Cancer Biology 2024Quote: ... were incubated at 37°C/5%CO2 and supplemented in 10% FBS and EGM™-2 Endothelial Cell Growth Medium-2 BulletKit™ (Lonza, Switzerland). HUVECs and all other cancer cell lines were sub-cultured as adherent cells every 2-3 days.
-
bioRxiv - Genomics 2020Quote: ... S2 cells were seeded at 2×106 per 6cm plate in 4 mL S2 medium (Lonza). One hour after plating ...
-
bioRxiv - Bioengineering 2023Quote: ... 2×109 Freestyle CHO-S cells were resuspended in 500ml ProCHO 4 Protein-free Medium (Lonza, Cat#BEBP12-029 ...
-
bioRxiv - Bioengineering 2024Quote: ... were cultured for a maximum of 4 passages cultured in EGM™-2 (Lonza #CC-4176) in T-175 or T-75 culture flasks (Thermo ...
-
bioRxiv - Cell Biology 2021Quote: ... siRNA directed against Dsg1 (Integrated DNA Technologies) with a targeting sequence 5′-CCATTAGAGAGTGGCAATAGGATGA-3′ using Amaxa Nucleofector System (Lonza) for electroporation of cells according to manufacturer’s instructions.
-
bioRxiv - Neuroscience 2024Quote: ... and 300μM single stranded oligodeoxynucleotides (ssODN: 5’gggtccagggtggctgtcactcat ccttttttctggctaccaaaggtgcagataattaaGaagaagctggatcttagcaacgtccagccaagtgtggctcaaaggataatatc aaacacgtcc 3’) and the P3 Primary Cell 4D reaction mix (Lonza). We screened a minimum of 96 clones for genetic editing ...
-
bioRxiv - Molecular Biology 2020Quote: ... at Day 3-4 of phase I culture were electroporated using P3 Primary Cell 4D NucleofectorTM X Kit (from Lonza) with program DZ100 (Bak et al. ...
-
bioRxiv - Immunology 2021Quote: ... 2.106 T cells were resuspended in 20 µl of nucleofection solution with 3 µl or 4 µl RNP and transferred to Nucleofection cuvette strips (4D-Nucleofector X kit S; Lonza). Murine T cells were electroporated using the DN110 program of 4D nucleofector (4D-Nucleofector Core Unit ...
-
bioRxiv - Cell Biology 2021Quote: ... were isolated from healthy donors (n=3) as described[4] and seeded on 6 cm dishes within BEGM media (Lonza) before transduction with lentivirus (empty vector (Origene ...
-
bioRxiv - Cell Biology 2024Quote: ... Cells were passaged 1:10 every 3-4 days by trypsinisation and were regularly screened for mycoplasma contamination (Mycoalert, Lonza).
-
bioRxiv - Cell Biology 2020Quote: ... expanded over 5-6 days of culture in EGM-2-medium (Lonza, CC-3156, CC-4176). Medium was aspirated and replaced by pre-warmed 10 mL serum-free EGM-2-medium per 10 cm/dish ...
-
bioRxiv - Immunology 2022Quote: Cryopreserved PBMC (2-5 × 106/sample) were thawed in prewarmed RPMI-1640 with L-glutamine (Lonza) + 10% FCS ...
-
bioRxiv - Cell Biology 2021Quote: ... 2 and 5 were isolated from human nonparenchymal liver cells (NPCs) purchased from Lonza (cat# HUCNP) as described previously (Chen et al. ...
-
bioRxiv - Cell Biology 2020Quote: ... expanded over 5-6 days of culture in EGM-2-medium (Lonza, CC-3156, CC-4176). Medium was aspirated and replaced by pre-warmed 10 mL serum-free EGM-2-medium per 10 cm/dish ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... Sf9 cells (4 × 105 cells* ml) in 2 ml of Insect-Xpress medium (Lonza, Walkersville, MD, USA) were transfected with recombinant bacmids using Cellfectin reagent (Life Technologies) ...
-
bioRxiv - Biochemistry 2023Quote: ... ∼2-4 million cells were electroporated using the T020 method of the Nucleofector™ 2b device (Lonza). Immediately after electroporation ...
-
bioRxiv - Cell Biology 2022Quote: ... ∼2-4 million cells were electroporated using the T020 method of the Nucleofector™ 2b device (Lonza). Immediately after electroporation ...
-
bioRxiv - Molecular Biology 2024Quote: ... Cells were washed with 4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid (HEPES) buffered saline solution (CC-5024, Lonza) before renewing the medium or passaging the cells ...
-
bioRxiv - Developmental Biology 2023Quote: iPSCs were transfected with sgRNA 3’ UCCCUUUCCUCAGGUCACAG 5’ (Synthego) via nucleofection using program CA137 on a 4D Nucleofactor X (Lonza) as per manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2021Quote: ... Human primary hepatic stellate cells from donors 3 and 4 were purchased as isolated hepatic stellate cells from Lonza (cat# HUCLS). Donor information is listed below.
-
bioRxiv - Developmental Biology 2021Quote: ... HESCs were transfected with a total of 4ug DNA in a ratio 2:3 (gRNAs:donor template) using the Amaxa P3 Primary Cell 4D-Nucleofector Kit (Lonza). Puromycin was added 3 days after electroporation at a concentration of 0.5ug/ml ...
-
bioRxiv - Cancer Biology 2024Quote: ... and (iv) the NDF-2 and NDF-3 cell lines (human neonatal dermal fibroblast cell lines, #CC-2509; Lonza Bioscience ...
-
bioRxiv - Cell Biology 2022Quote: Human umbilical vein endothelial cells (HUVEC) were cultured between passage 3 and 6 in EGM-2 complete medium (Lonza)3,52–55 ...
-
bioRxiv - Molecular Biology 2024Quote: ... Cells were harvested with trypsin, pelleted (500 g, 5 min, 4°C) and resuspended in PBS (pH 7.4) containing EDTA (Lonza) and 10% fetal bovine serum ...
-
bioRxiv - Biochemistry 2023Quote: ... Cells were harvested with trypsin, pelleted (500 g, 5 min, 4°C) and resuspended in PBS (pH 7.4) containing EDTA (Lonza) and 10% fetal bovine serum ...
-
bioRxiv - Bioengineering 2024Quote: ... The hUVEC cells were cultured and expanded until passage 5 with EGM-2 media (CC-3156, Lonza) and SingleQuot supplements (CC-4176 ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... Sf9 cells (4 x 105 cells*ml) in 2 ml of Insect-Xpress medium (Lonza; Cat#BE12-730P10) were transfected with recombinant bacmids using Cellfectin II reagent (Gibco-Thermo Fisher Scientific™ ...
-
bioRxiv - Bioengineering 2021Quote: ... and electroporated with 2-4pmol HDR template using a 4-D Nucleofector with pulse code CM-150 (Lonza). VLP/template mix was added to 15,000 cells in 50ul DMEM +10% FBS and 1x penicillin/streptomycin.
-
bioRxiv - Molecular Biology 2023Quote: ... ∼2-4 million cells were electroporated using the T-020 method of the Nucleofector™ 2b device (Lonza). Immediately after electroporation ...
-
bioRxiv - Immunology 2020Quote: ... Transfection of primary T cells with Cas9 RNP complexes and TCRβα HDR templates was performed 3-4 days following activation using the 4D-Nucleofector and a 20 uL format P3 Primary Cell kit (Lonza, V4XP-3032). Briefly ...
-
bioRxiv - Cell Biology 2022Quote: ... All cell lines were tested to be negative for mycoplasma every 2–3 months using the MycoAlert Mycoplasma Detection Kit (Lonza).
-
bioRxiv - Genetics 2020Quote: ... hESCs were nucleofected with 2 μg of CRISPR and 3 μl ssODN (100 μm) using the P3 Primary Cell Kit L (Lonza). hESCs were then plated onto puromycin-resistant (DR4 ...
-
bioRxiv - Pathology 2024Quote: Primary human lung fibroblasts from either IPF patients (n=4) or donors with no history of lung fibrosis (n=5) were purchased from Lonza at P2 (Supplementary Table 6) ...
-
bioRxiv - Genetics 2020Quote: ... 20 µg ssODNs and 4 µg pSpCas9(BB)-2A-GFP construct using Human Stem Cell Nucleofector Kit 2 (Lonza). For the generation of UE-RASGEF1A-int1-KO and PIK3C2B-int10-KO hPSC lines ...
-
bioRxiv - Cell Biology 2020Quote: ... U–2–OS-pEP15 cells (5) were maintained in 1 mg/ml glucose phenol-red-free DMEM (Lonza) supplemented with steroid-free FBS (Thermo Fisher Scientific) ...
-
bioRxiv - Physiology 2023Quote: ... USA) were cultured in 5% fetal bovine serum containing endothelial cell growth medium (EGM-2; Lonza, Basel, Switzerland). Media was supplemented with heparin ...
-
bioRxiv - Bioengineering 2022Quote: ... GM-3TM Lymphocyte Growth Medium-3 (LGM-3™) (Lonza), Opti-MEM Serum-Free medium (Thermofisher) ...
-
bioRxiv - Developmental Biology 2021Quote: ... and 5 µg of PX459 gRNA vector (5’-GACTCCAGTCTTTCTAGAAGA-3’) were nucleofected with the AMAXA Mouse Embryonic Stem Cell Nucleofector Kit (LONZA, VPH-100) using program A-30 in the XRep ...
-
bioRxiv - Cancer Biology 2022Quote: A small fragment (2-4 mm3) of tumor biopsies or surgically resected tumor was cultured in RPMI 1640 plus (Lonza) containing 10% FBS Hyclone (GE Healthcare) ...
-
bioRxiv - Microbiology 2022Quote: ... for 24 h then interleukin-2 (50U/ml) for 4-6 days before nucleofection (as recommended by the manufacturer, Lonza) or infection by HIV-1.
-
bioRxiv - Neuroscience 2021Quote: ... the suspension was centrifuged (215g for 5min at 4°C) and the pellet was resuspended in BMEC-media that comprised of EBM-2 medium (Lonza) supplemented with the following ...
-
bioRxiv - Cell Biology 2024Quote: ... supplemented with 11 mM glucose and 25 mM HEPES (4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid) pH 7.4 (Lonza, Basel, Switzerland). The apical (AP ...