Labshake search
Citations for Lonza :
51 - 100 of 2280 citations for Cow Caprin 1 CAPRIN1 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Synthetic Biology 2022Quote: ... T cells were resuspended in P3 buffer (0.75-1 x 106 cells per 18 μl P3) from the P3 Primary Cell 4D-Nucleofector X Kit S (Lonza). 10 μg/μl Alt-R S.p ...
-
bioRxiv - Cell Biology 2022Quote: ... Two million of MNCs were transfected with 10 μg of plasmid (5:1 ratio pEB-C5:pEBTg) as instructed by the Lonza CD34+ nucleofector kit (VPA-1003, Lonza) and Amaxa nucleofector (program T-016 ...
-
bioRxiv - Microbiology 2023Quote: ... Knock-down procedures were performed with siRNA purchased from Riboxx (non-targeting siRNA: UUGUACUACACAAAAGUACCCCC; US10 targeting #1: UUCUGAAUAACACAGCCGCCCCC) applying the SE Cell Line Kit (Lonza) for fibroblasts and Lipofectamine RNAiMax (Invitrogen ...
-
bioRxiv - Microbiology 2023Quote: ... Ribonucleoproteins were introduced into 1 x 106 sub-confluent BLaER1 cells using 4D-Nucleofector X Unit and SF Cell line Kit (Lonza), applying program DN-100 ...
-
bioRxiv - Molecular Biology 2023Quote: ... 5-6 million primary human keratinocytes were electroporated with 1 nmol siPools using the Amaxa human keratinocyte Nucleofector kit (Lonza) according to the manufacturer’s instructions and the T-018 program of the Amaxa Nucleofector II device (Lonza) ...
-
bioRxiv - Cell Biology 2023Quote: ... were delivered as a ribonucleoprotein complex with the DNA donor template using a Nucleofector 2b Device and the Human Stem Cell Nucleofector Kit 1 (Lonza) following manufacturer’s instructions ...
-
bioRxiv - Biophysics 2023Quote: ... MCF7 and A375 cells (ATCC) were transfected with 1 μg DNA using the SF Cell Line 4D-Nucleofector kit (Lonza) following the manufacturer’s instructions via electroporation (4D-Nucleofector ...
-
bioRxiv - Molecular Biology 2024Quote: ... 2 × 106 OSCs were transfected with 4 μg of pPB-TRE3G-FLAG-Rhino-Tjen-trTA-P2A-BlastR and 1 μg of pHsp70-Myc-hyPBase using Nucleofector Kit V (Lonza). After incubation in media containing blasticidin (50 μg/mL) ...
-
bioRxiv - Cell Biology 2024Quote: ... together with a plasmid encoding the piggyBac transposase in a 3:1 ratio (vector:transposase) using the P3 Primary cell 4D-Nucleofector™ kit (Lonza). Prior to targeting ...
-
bioRxiv - Cell Biology 2020Quote: BMDMs (1 × 106 cells) were transfected with siRNA (250 pmol) and Amaxa Mouse Macrophage Nucleofector Kit (Lonza, catalog number VPA-1009) using a Lonza Nucleofector 2b device (Lonza ...
-
bioRxiv - Microbiology 2021Quote: ... The Ala324Thr and the Glu655Asp mutations were independently recreated by transfecting the respective sgRNA template and donor dsDNA using the Basic Parasite Nucleofector™ Kit 1 (Lonza) with the U-033 program following manufacturer recommendations ...
-
bioRxiv - Genomics 2021Quote: ... K562 cells were grown to a density of 1×106 cells and electroporated with 5μg of plasmid DNA (Amaxa® Cell Line Nucleofector® Kit V, Lonza). Cells from each cell line were cultured for an additional 48 hours until total RNA isolation (Maxwell RSC simplyRNA kit ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... and PX458-AAVS1 (3 µg) were electroporated into 1.3×106 H9 cells using the Human Stem Cell Nucleofector Kit 1 (Lonza, VPH-5012). Following electroporation the cells were seeded across 3-wells of a 6 well plate coated with Matrigel in StemFlex supplemented with RevitaCell supplement (Thermo Fisher ...
-
bioRxiv - Developmental Biology 2022Quote: ... 400,000 H9 cells for each condition were electroporated with 1 μg plasmid via a human stem cell nucleofector™ kit (VPH-5012) by Lonza AMAXA Nucleofector 2B.
-
bioRxiv - Microbiology 2022Quote: ... NuLi-1 cells routinely tested negative for mycoplasma infection using MycoAlert Mycoplasma Detection Kit (LT07-418, Lonza Group AG, Basel, Switzerland) according to the manufacturer’s instructions.
-
bioRxiv - Cell Biology 2023Quote: ... brucei 13-90 cells were electroporated with 10 µg of linearised plasmid DNA using the Amaxa Basic Parasite Nucleofector Kit 1 and Nucleofector II device (program X-001) (Lonza, Switzerland).
-
bioRxiv - Cell Biology 2024Quote: ... and a control siRNA (D-001810-01-20 ON-TARGET plus Nontargeting siRNA #1) were prepared for electroporation using the Lonza SF Cell Line 4D-Nucleofector™ X Kit (V4XC-2012; Lonza) according to the manufacturer’s instruction with minor alterations ...
-
bioRxiv - Cell Biology 2020Quote: 1 million Jurkat cells were electroporated with the 2.5 μg of sgRNA plasmid and GFP control plasmid at a 10:1 ratio using an Amaxa Cell Line Nucleofector Kit V and an Amaxa™ Nucleofector™ II (Lonza). HeLa ...
-
bioRxiv - Immunology 2021Quote: ... 1.5×106 cells multiplied by the number of mice to be injected were transfected with the pIL-10 vector (1×106 cells/1.5 μg pIL-10 DNA per cuvette) using the Mouse T Cell Nucleofector Kit (Lonza, No: VPA-1006) with Nucleofector II Device (program X-100) ...
-
bioRxiv - Developmental Biology 2020Quote: ... about 8 × 105 iPSCs were transfected with 5 μg of plasmids with Lonza Human Stem Cell Nucleofector Kit 1 (Lonza, VPH-5012) on a Nucleofector 2b device (Lonza ...
-
BRD2 inhibition blocks SARS-CoV-2 infection by reducing transcription of the host cell receptor ACE2bioRxiv - Cell Biology 2021Quote: ... complex with a ratio of 4.5 to 1 between sgRNA and Cas9 was delivered following the protocol of the SE Cell Line 4D-NucleofectorTM X Kit (Lonza, V4XC-1012), using the nucleofection program DS-130 on the Lonza 4D X unit ...
-
bioRxiv - Cell Biology 2021Quote: ... 500μg of gRNA and 500μg of donor plasmids were electroporated in 1×106 mESC using P3 Primary Cell 96-well Nucleofector™ Kit (Lonza, PBP3-22500) according to manufacturer’s instruction ...
-
bioRxiv - Biophysics 2022Quote: ... 106 U2OS cells were transfected with 1 μg of px330 plasmid and 1 μg of the HDR donor plasmid using the Nucleofector 2b device and cell line nucleofector kit V (Lonza, VCA-1003) per manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2021Quote: ... 5 µg of sgRNA and 5 µg of ssDNA donor template (Table S1) using Human Stem Cell NucleofectorTM kit 1 (Lonza, VVPH-5012) according to the manufactures protocol and cells replated ...
-
bioRxiv - Cancer Biology 2021Quote: ... Cells were transfected with pcDNA3.1 empty vector or pcDNA3.1 containing the human coding sequence of the VGLL2-NCOA2 fusion using the AMAXA cell line Nucleofection kit V (Lonza #VCA-1003;) and were selected in growth media containing 1μg/ml concentration of G418 (ThermoFisher #10131035) ...
-
bioRxiv - Molecular Biology 2023Quote: Induced pluripotent stem cells were transfected with a total of 5 μg target Cas9/gRNA plasmids with or without 1 μg repair templates using Human Stem Cell Nucleofector Kit (LONZA, Basel, Switzerland) and Nucleofector 2b device (LONZA ...
-
bioRxiv - Genomics 2023Quote: ... 200,000 cells were nucleofected with 50 fmol transposon and 50 fmol transposase (Super piggyBac Transposase - SystemBio PB210PA-1) or with 300 ng pmaxGFP using the P2 Primary Cell 4D Nucleofector kit (Lonza V4SP-2096) and the Lonza 4D- Nucleofector with the DS-150 program ...
-
bioRxiv - Cancer Biology 2023Quote: ... 1% Ultraglutamine 1 (Lonza), 1% B27 (Sigma-Aldrich) ...
-
bioRxiv - Molecular Biology 2019Quote: ... buffer kit V (Lonza) and program A-023 ...
-
bioRxiv - Cancer Biology 2021Quote: Mycoplasma Detection Kits (Lonza) and MycoSensor qPCR Assay Kits (Agilent Technologies ...
-
bioRxiv - Cancer Biology 2023Quote: ... (kit C, W001; Lonza) and CD81 positive cells sorted (ARIA III BD ...
-
bioRxiv - Neuroscience 2020Quote: ... two pairs of sgRNA vectors and Cas9 nickase plasmid were transduced into the AD hPSCs by using Human Stem Cell Nucleofector® Kit 1 (Lonza VPH-5012). Three days after electroporation ...
-
bioRxiv - Microbiology 2021Quote: ... electroporated with 10 μg of linearised plasmid DNA or PCR product using the Amaxa Basic Parasite Nucleofector Kit 1 and Nucleofector II device (Lonza, Switzerland, program X-001).
-
bioRxiv - Neuroscience 2023Quote: ... 4−106 cells were pelleted at 300xg and then resuspended in 100 μL prewarmed nucleofector solution (Human Stem Cell Kit 1, Lonza, catalog no. VPH-5012); 4 μg of NGN2 plasmid and 1.5 μg each of 1R and 1L plasmids were added directly to the resuspended cells ...
-
bioRxiv - Immunology 2019Quote: The Nucleofector transfection kit (Lonza) was used to transfect siRNA into cells ...
-
bioRxiv - Microbiology 2023Quote: A ToxiLight BioAssay Kit (Lonza) was used to determine cell death ...
-
bioRxiv - Microbiology 2023Quote: ... and Nucleofector Kit R (Lonza) following manufacturer instructions ...
-
bioRxiv - Molecular Biology 2024Quote: ... using ToxiLight bioassay kit (Lonza) according to the manufacture’s recommendations.
-
bioRxiv - Cancer Biology 2023Quote: ... 1% of penicillin-streptomycin and 1% of Ultraglutamine-1 (Lonza, Basel, Switzerland). U-2 OS cells were grown in high-glucose DMEM (Sigma-Aldrich ...
-
bioRxiv - Biophysics 2019Quote: ... These growth factors were supplied as a bullet kit (Cell Media and Bullet Kit, Lonza). HUVECs were passaged 2-6 times.
-
bioRxiv - Physiology 2022Quote: ... in F12 : DMEM (1 : 1) (Lonza, UK). Following digestion the suspension was passed through sterile gauze and a 70 µm cell strainer before centrifugation at 350 g for 10 minutes ...
-
bioRxiv - Immunology 2020Quote: ... The MycoAlert Mycoplasma Detection Kit (Lonza) was used to monitor mycoplasma contamination on a regular basis.
-
bioRxiv - Bioengineering 2019Quote: ... and EGM-2 bullet kit (Lonza)) and maintained at ALI for three weeks.
-
bioRxiv - Developmental Biology 2019Quote: ... using a HUVEC Nucleofector kit (Lonza) according to manufacturer’s instructions and the cells were further cultured for 72 hours ...
-
bioRxiv - Cancer Biology 2019Quote: ... using the MycoAlert Kit (Lonza, Switzerland). NIH3T3 mouse embryonic fibroblasts were stably transfected with pCMV_HER4 that encodes the JMa/CYT1 isoform ...
-
bioRxiv - Immunology 2021Quote: ... and Nucleofector kits (Lonza, VPB-1002) following the manufacturer’s instruction ...
-
bioRxiv - Cancer Biology 2022Quote: ... MycoAlert Mycoplasma Detection Kit (Lonza, Bioscience). Each cell lines were used within passage 4/5 since their thawing from originally frozen vials.
-
bioRxiv - Cancer Biology 2022Quote: ... Mycoplasma testing (MycoAlert Detection Kit, Lonza) was performed monthly.
-
bioRxiv - Cell Biology 2022Quote: ... using MycoAlert detection kit (Lonza, LT07). Additionally ...
-
bioRxiv - Cancer Biology 2022Quote: ... Regular testing with MycoAlert kit (Lonza) confirmed the absence of mycoplasma contamination ...