Labshake search
Citations for Lonza :
51 - 100 of 1265 citations for 6 Methyl benzo 1 3 dioxole 5 carbaldehyde since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2020Quote: ... 10 μg of RNA were fractionated on a 2% NuSieve 3:1 agarose (Lonza), 1X MOPS ...
-
bioRxiv - Microbiology 2023Quote: ... 10 μg of RNA were fractionated on a 2% NuSieve 3:1 agarose (Lonza), 1X MOPS ...
-
bioRxiv - Microbiology 2023Quote: ... with a final concentration of 2% formaldehyde and 2% NuSieve 3:1 agarose (Lonza). 5 µg RNA was denatured for 10 min at 70 °C with 1 X MOPS buffer (20 mM MOPS ...
-
bioRxiv - Microbiology 2024Quote: ... 10 μg of RNA were fractionated on a 2% NuSieve 3:1 agarose (Lonza), 1X MOPS ...
-
bioRxiv - Bioengineering 2022Quote: ... GM-3TM Lymphocyte Growth Medium-3 (LGM-3™) (Lonza), Opti-MEM Serum-Free medium (Thermofisher) ...
-
bioRxiv - Developmental Biology 2021Quote: ... and 5 µg of PX459 gRNA vector (5’-GACTCCAGTCTTTCTAGAAGA-3’) were nucleofected with the AMAXA Mouse Embryonic Stem Cell Nucleofector Kit (LONZA, VPH-100) using program A-30 in the XRep ...
-
bioRxiv - Physiology 2022Quote: ... (5 g/L trypsin and 2 g/L EDTA diluted 1 in 5 in calcium- and magnesium-free PBS) (Lonza, UK).
-
bioRxiv - Molecular Biology 2021Quote: ... and Alt-R™ HDR donor oligo 5’ GTGTTTAGAAAAAAAAGAGTGTTTTTTTACCAGGGCCTTTGGCTCTTCCAGGAAGCAGATGTCCGAGTCGGAATATAATAACCCTTTCATACTCTTG 3’ (PS modification, antisense; IDT) using a 4D-nucleofector System X Unit (Lonza, Basel, Switzerland) and the P3 primary Cell 4D-Nucleofector® X kit (#V4XP-3024 ...
-
bioRxiv - Cancer Biology 2024Quote: ... 1×106 T cells were transfected with Cas9/RNPs complexes of CD38 targeting guide RNA 5’-AGUGUAUGGGAUGCUUUCAA -3’ (Synthego) using Lonza 4D-Nucleofector™ X Unit (Lonza, AAF-1003X). Transfection was carried out in P3 Primary Cell 4D-Nucleofector™ Solution (Lonza ...
-
bioRxiv - Cell Biology 2020Quote: ... Cells in passage 1 were trypsinized and resuspended (3 × 104 cells/mL) in BEGM** (Lonza, see Table S4 for details of media composition ...
-
bioRxiv - Microbiology 2023Quote: ... 6 mmol/L l-glutamine (Lonza®), and a mixture of penicillin/streptomycin (100U/100 μg/mL ...
-
bioRxiv - Cancer Biology 2023Quote: ... the cell pellet was resuspended in 1-5 ml ACK lysis buffer (Lonza), according to the pellet size ...
-
bioRxiv - Synthetic Biology 2021Quote: ... Isolated NK cells were activated at 1 x 106 cells mL-1 for 5 days in XVivo15 medium (Lonza) with 5% fetal bovine serum ...
-
bioRxiv - Immunology 2022Quote: ... were coated overnight at 4°C with 25μL of SEC fractions 1 to 5 diluted 1:2 with PBS (Cat. No. LZBE17-512F, Lonza). Wells were washed with 0.05% Tween-20 (Cat ...
-
bioRxiv - Cell Biology 2020Quote: ... were resuspended at a density of 6×106 cells mL−1 in Microvascular Endothelial Cell Growth Medium-2 media (EGM-2MV, Lonza). The bottom channel of the chip was washed with EGM-2MV and loaded with 6 μL of HIMEC cell suspension (~36,000 cells per chip) ...
-
bioRxiv - Neuroscience 2022Quote: ... MSCs (2×104 in 6 μl, Lonza, UK) were injected in DMM operated mice at 14 weeks following the surgery ...
-
bioRxiv - Neuroscience 2019Quote: ... followed immediately by engrafting 1-5×104 human umbilical cord CD34+ stem cells (Lonza Incorporated ...
-
bioRxiv - Cell Biology 2020Quote: ... and 8 × 105 cells were electroporated using 5 mg of total DNA (Ratio 1:1) and the Amaxa Nucleofector kit (Lonza) as described (Ran et al. ...
-
bioRxiv - Genomics 2020Quote: ... donors (passage 2-3; Lonza) were continuously passaged to replicative exhaustion in complete Endopan-2 supplemented with 2% FBS under 5% CO2 ...
-
bioRxiv - Molecular Biology 2019Quote: ... a modified antisense or control oligonucleotide (1 μM) was transfected into 3 × 106 cells using Nucleofector technology (Lonza) 16–18 h before the assay ...
-
bioRxiv - Cell Biology 2023Quote: ... RPE1 cell pellets containing 1×10^6 cells were resuspended in Nucleofection Solution for Primary Mammalian Epithelial Cells (Lonza cat# VPI-1005) in the presence of nucleofection enhancer (cat# 1075915 ...
-
bioRxiv - Biophysics 2021Quote: ... HUVECs (Lonza, expanded to passage 3) were transduced with GFP tagged VE-cadherin (65 ...
-
bioRxiv - Cancer Biology 2023Quote: ... 3 μg of pmaxGFP plasmid (Lonza) was added to transfection mixes to monitor transfection efficiency ...
-
bioRxiv - Neuroscience 2021Quote: ... Tissues were washed 3-4 times over 1 hour in PBS (calcium- and magnesium-free; Lonza BioWhittaker #17-517Q) containing 0.1% Triton X-100 (PBT ...
-
bioRxiv - Bioengineering 2019Quote: K562 cells were transfected with two gRNAs targeting exon 1 and 3 of NGLY1 and Cas9 plasmid (lentiCas9-Blast) by Nucleofection according to the manufacturer’s protocol (Nucleofector, Lonza). LentiGuide-Puro (Addgene plasmid #52963 ...
-
bioRxiv - Immunology 2022Quote: ... -coated 6-well plates in X-VIVO 15 media (Lonza), supplemented with rhActivin A ...
-
bioRxiv - Biochemistry 2020Quote: ... Tissues were embedded in 6% low-melting point agarose (Lonza) for two minutes on ice ...
-
bioRxiv - Immunology 2024Quote: ... and used at passage 6 (Lonza, CC-3156 & CC-4147). Primary human brain pericytes were obtained from Cell Systems (ACBRI 498) ...
-
bioRxiv - Microbiology 2023Quote: ... plates were incubated at 37°C for 30 minutes in blocking buffer (PBS with 1% BSA, 5% FBS, and 1% human AB serum (Lonza, Walkersville, MD, USA), washed three times in PBS with 0.05% tween 20 and incubated with a commercial anti-SARS-CoV-2 Spike antibody (1/1000 ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... Measured tissues originated from six F508del homozygous patients (CF patient #1: CF-AB0609, female, 31 years-old; CF patient# 3: #28388-0000450918, Lonza, male ...
-
bioRxiv - Cell Biology 2024Quote: ... together with a plasmid encoding the piggyBac transposase in a 3:1 ratio (vector:transposase) using the P3 Primary cell 4D-Nucleofector™ kit (Lonza). Prior to targeting ...
-
bioRxiv - Cell Biology 2024Quote: ... Cells were passaged 1:10 every 3-4 days by trypsinisation and were regularly screened for mycoplasma contamination (Mycoalert, Lonza).
-
bioRxiv - Bioengineering 2022Quote: ... and 3% FBS (all from Lonza Biosciences), termed astrocyte medium ...
-
bioRxiv - Microbiology 2020Quote: ... or 6 days in growth factor-free Keratinocyte Basal Medium (Lonza) supplemented to achieve 1.5 mM [final] CaCl2.
-
bioRxiv - Neuroscience 2021Quote: ... 6 hours post transfection cells were switched to Ultraculture medium (Lonza) and grown for another 24-48hrs ...
-
bioRxiv - Immunology 2023Quote: ... and embedded in 6% w/v low melting point agarose (Lonza) in 1x PBS ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: Dry powder (2-3 mg) was loaded into an HPMC size 3 capsule (VCaps® Plus, Lonza, Morristown, NJ). The capsule was placed in a Plastiape high resistance RS00 DPI that was then attached to a Next Generation Impactor (NGI ...
-
bioRxiv - Genetics 2019Quote: ... Between 1×10^4 – 5×10^4 cells per condition were resuspended in 20μl of Buffer P3 (Lonza) per reaction and quickly added to the Eppendorf tube containing the Cas9 gRNA RNP complex ...
-
bioRxiv - Neuroscience 2022Quote: ... Homogenized samples were then diluted 1:5 in endotoxin free water in pyrogen-free glass tubes (Lonza N207) and tested for endotoxin in duplicate using a Kinetic-QCL™ LAL Assay (Lonza ...
-
bioRxiv - Cell Biology 2019Quote: ... 5×104−1×105 fresh isolated DRG neurons were transfected with 0.5 μg Mito-GFP for Nucleofector (Lonza) SCN Basic Neuro Program 6 with Amaxa Basic Neuron SCN nucleofector Kit ...
-
bioRxiv - Cell Biology 2020Quote: ... U–2–OS-pEP15 cells (5) were maintained in 1 mg/ml glucose phenol-red-free DMEM (Lonza) supplemented with steroid-free FBS (Thermo Fisher Scientific) ...
-
bioRxiv - Bioengineering 2019Quote: ... The plate containing the amplified genes or qPCR products was kept in ice and observed in a 2% agarose gel (NuSieve® 3:1 Agarose (Lonza)) to check and reinforce the identity of the amplicons ...
-
bioRxiv - Microbiology 2021Quote: ... Vero cell cultures were seeded at 1-3 × 104 cells/cm2 in Dulbecco’s minimal essential medium (DMEM, LONZA, Alpharetta, GA, USA) supplemented with 9% foetal bovine serum (FBS ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... and PX458-AAVS1 (3 µg) were electroporated into 1.3×106 H9 cells using the Human Stem Cell Nucleofector Kit 1 (Lonza, VPH-5012). Following electroporation the cells were seeded across 3-wells of a 6 well plate coated with Matrigel in StemFlex supplemented with RevitaCell supplement (Thermo Fisher ...
-
bioRxiv - Systems Biology 2021Quote: ... and routinely passaged every 4∼6 days with Versene (EDTA) solution (Lonza). Selected iPSC clones were further validated for expression of pluripotency markers with immunostaining (Supplementary Fig ...
-
bioRxiv - Systems Biology 2021Quote: ... and routinely passaged every 4~6 days with Versene (EDTA) solution (Lonza). Selected iPSC clones were further validated for expression of pluripotency markers with immunostaining (Chen et al. ...
-
bioRxiv - Immunology 2022Quote: ... supplemented with fetal calf serum (FCS, 3%, Lonza) and HEPES (1.8%) ...
-
bioRxiv - Immunology 2022Quote: ... supplemented with fetal calf serum (FCS, 3%, Lonza) and HEPES (1.8% ...
-
bioRxiv - Cell Biology 2019Quote: ... and separated on a 3% MetaPhor gel (Lonza).
-
bioRxiv - Microbiology 2023Quote: ... and 3 ml of ACK lysis buffer (Lonza) was added to the cells and incubated for 5 min ...