Labshake search
Citations for Lonza :
51 - 100 of 1483 citations for 6 Methyl 3 5 heptadien 2 one since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Bioengineering 2019Quote: ... mCherry-transfected) were cultured at 37°C in 5% CO2 in EGM®-2 Endothelial Cell Growth Medium-2 (Lonza). Patient-derived glioblastoma multiform (GBM ...
-
bioRxiv - Biophysics 2023Quote: ... Any CD146 positive cells were eluted from the column using 5 mL warmed EGM-2 growth medium supplemented with EGM-2 bullet kit (Lonza). The cells were pelleted with a 300 g spin for 5 min and counted in 1 mL EGM-2 media ...
-
bioRxiv - Biophysics 2023Quote: ... 95% humidity and 5% CO2 in Fibroblast Growth Medium (FGM-2, Lonza, Basel).
-
bioRxiv - Bioengineering 2023Quote: ... were cultured at 37°C and 5% CO2 with EBM-2 medium (Lonza) and EGM-2MV supplements in T-75 flasks until confluent ...
-
bioRxiv - Immunology 2020Quote: ... Slices were immediately placed in a 6-well plate containing 3 mL per well of “complete RPMI”: RPMI (Lonza, 16-167F) supplemented with 10 % FBS (VWR ...
-
bioRxiv - Physiology 2022Quote: ... (5 g/L trypsin and 2 g/L EDTA diluted 1 in 5 in calcium- and magnesium-free PBS) (Lonza, UK).
-
bioRxiv - Cancer Biology 2021Quote: Primary human lung microvascular endothelial cells (HMVEC-L) were seeded at 5000 cells/cm2 in EBM-2 with 5% FBS and EGM-2 supplement (all products, Lonza Bioscience) until reaching complete confluence 14 ...
-
bioRxiv - Cell Biology 2022Quote: ... Electroporation with the CA-137 program was performed 3-5 min after this addition (Lonza Group AG). Following this ...
-
bioRxiv - Immunology 2023Quote: ... MEFs were allowed to expand for 2-3 days before harvest with 0.05% trypsin-EDTA (Lonza). iBMDMs were immortalized with J2 virus to generate iBMDMs.
-
bioRxiv - Bioengineering 2022Quote: Two donors of human mesenchymal stem cells (hMSCs) at passage 5-6 were seeded on mineralized collagen scaffolds for osteogenesis experiments (seeded separately, BM-17, Lonza, Maryland ...
-
bioRxiv - Neuroscience 2019Quote: ... of viral supernatants were used to infect E2T cells (5 x 105 cells/well in 6-well plate) for plaque assays and cells were maintained in culture medium containing 5% SeaPlaque agarose (Lonza) until plaques become visible at ∼12 days after infection ...
-
bioRxiv - Molecular Biology 2023Quote: ... 5-6 million primary human keratinocytes were electroporated with 1 nmol siPools using the Amaxa human keratinocyte Nucleofector kit (Lonza) according to the manufacturer’s instructions and the T-018 program of the Amaxa Nucleofector II device (Lonza) ...
-
bioRxiv - Immunology 2021Quote: ... coated dishes (5 ng/cm2) and cultured in Endothelial Growth Medium 2 (EGM2, Lonza) supplemented with 50 ng/mL VEGF with medium changes every other day until they reached confluency ...
-
bioRxiv - Neuroscience 2022Quote: ... Harvested EBs were transferred to a tissue-culture treated 6-well plate (Falcon, #353224) in 3 ml of EB Differentiation media: X-VIVO 15 (Lonza Biosciences, #04-418Q) + 1% Glutamax (Life Technologies ...
-
bioRxiv - Cell Biology 2020Quote: ... were resuspended at a density of 6×106 cells mL−1 in Microvascular Endothelial Cell Growth Medium-2 media (EGM-2MV, Lonza). The bottom channel of the chip was washed with EGM-2MV and loaded with 6 μL of HIMEC cell suspension (~36,000 cells per chip) ...
-
bioRxiv - Developmental Biology 2021Quote: ... and E15.5 (n=2–6) Six2-TROMA-1 stained kidneys were embedded in 1 % low melting agar (50100; Lonza Group). The lateral cortex of the kidneys was imaged with a Nikon A1R MP+ multiphoton microscope (Tokyo ...
-
bioRxiv - Microbiology 2022Quote: ... for 24 h then interleukin-2 (50U/ml) for 4-6 days before nucleofection (as recommended by the manufacturer, Lonza) or infection by HIV-1.
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... Successful test compounds from the mf assay were diluted to 10 μM and added to the trans-wells in 6 ml endothelial basal media with supplements (EGM-2 MV; Lonza). Twelve replicates (n = 6 wells ...
-
bioRxiv - Bioengineering 2022Quote: ... 30 µl was mixed with 6 µl 6X gel loading dye and run on a 50 ml gel containing 2% SeaKem Agarose (Lonza), 1x Tris-Acetate-EDTA (Boston BioProducts) ...
-
bioRxiv - Bioengineering 2023Quote: ... washed three times in PBS and cultured on collagen-coated 6-well plates in endothelial growth medium (EGM-2, Lonza) composed of endothelial basal medium supplemented with 2% fetal bovine serum ...
-
bioRxiv - Cell Biology 2023Quote: ... cultured for 48 h at 37°C with 5% CO2 in EGM™-2 Endothelial Cell Growth Medium-2 BulletKit™ (Lonza, UK) with penicillin–streptomycin (100_U/ml ...
-
bioRxiv - Cell Biology 2023Quote: ... cultured for 48 h at 37°C with 5% CO2 in EGM™-2 Endothelial Cell Growth Medium-2 BulletKit™ (Lonza, UK) with penicillin–streptomycin (100_U/ml ...
-
bioRxiv - Cell Biology 2023Quote: ... The cells were used from passages 5-9 for the experiments and were cultured in endothelial cell growth Medium-2 (EGM™-2) Bulletkit™ (Lonza Bioscience) on pretreated tissue culture 6-well plate (VWR international) ...
-
bioRxiv - Cancer Biology 2020Quote: ... One million cells were electroporated (Nucleofector, Lonza), and after 48h ...
-
bioRxiv - Cancer Biology 2021Quote: ... Primary uveal melanoma cells were equally divided onto two wells of a fibronectin-covered 6-well tissue culture plate and grown in 5% CO2 in MDMF medium which consists of HAM’s F12 (Lonza, Walkersville MD, USA) supplemented with 1 mg/mL BSA (Sigma-Aldrich ...
-
bioRxiv - Cancer Biology 2019Quote: ... 5 × 106 cells were co-transfected with 5 μg of pSpCas9(BB)– 2A–Puro:sgRNA #4 plasmid and 5 μg of pCSII–CMV:A3B–3×FLAG–IRES–EGFP donor DNA plasmid using the Amaxa Nucleofector (Lonza) with nucleofection solution R ...
-
bioRxiv - Cell Biology 2021Quote: ... siRNA directed against Dsg1 (Integrated DNA Technologies) with a targeting sequence 5′-CCATTAGAGAGTGGCAATAGGATGA-3′ using Amaxa Nucleofector System (Lonza) for electroporation of cells according to manufacturer’s instructions.
-
bioRxiv - Immunology 2022Quote: Cryopreserved PBMC (2-5 × 106/sample) were thawed in prewarmed RPMI-1640 with L-glutamine (Lonza) + 10% FCS ...
-
bioRxiv - Cell Biology 2021Quote: ... 2 and 5 were isolated from human nonparenchymal liver cells (NPCs) purchased from Lonza (cat# HUCNP) as described previously (Chen et al. ...
-
bioRxiv - Genetics 2020Quote: ... ∼1×106 cells were transfected with pairs of 5 µg gRNA plasmid and 4 µg ssODN (Supplementary Table 3) using AmaxaTM Human CD34 Cell NucleofectorTM Kit (Lonza) in the 2B-NucleofectorTM on the U-08 setting ...
-
bioRxiv - Developmental Biology 2023Quote: iPSCs were transfected with sgRNA 3’ UCCCUUUCCUCAGGUCACAG 5’ (Synthego) via nucleofection using program CA137 on a 4D Nucleofactor X (Lonza) as per manufacturer’s instructions ...
-
bioRxiv - Microbiology 2022Quote: ... pre-coated cell culture 6-well plate with EBM-2 endothelial media supplemented with 10% FBS and a growth factor bullet kit (Lonza, Walkersville, USA) 3 mL/well ...
-
bioRxiv - Cancer Biology 2019Quote: ... NSCs were harvested with Accutase and 2-3×106 cells were resuspended in 100µl mouse neural stem cell nucleofector buffer (Lonza) with 2µg plasmid DNA ...
-
bioRxiv - Developmental Biology 2021Quote: ... HESCs were transfected with a total of 4ug DNA in a ratio 2:3 (gRNAs:donor template) using the Amaxa P3 Primary Cell 4D-Nucleofector Kit (Lonza). Puromycin was added 3 days after electroporation at a concentration of 0.5ug/ml ...
-
bioRxiv - Cancer Biology 2024Quote: ... and (iv) the NDF-2 and NDF-3 cell lines (human neonatal dermal fibroblast cell lines, #CC-2509; Lonza Bioscience ...
-
bioRxiv - Biochemistry 2020Quote: One straw of passage 4 HUVECs (Lonza, USA) was thawed in a 35mm dish and cultured in EGM-2 medium until almost 80% confluence is reached ...
-
bioRxiv - Bioengineering 2024Quote: ... The hUVEC cells were cultured and expanded until passage 5 with EGM-2 media (CC-3156, Lonza) and SingleQuot supplements (CC-4176 ...
-
bioRxiv - Bioengineering 2023Quote: Cells were cultured at 37°C and 5% CO2 in cell-specific media: primary human umbilical vascular endothelial cells (HUVECs, Lonza; up to passage 6) in EGM-2 (Lonza ...
-
bioRxiv - Cell Biology 2022Quote: ... All cell lines were tested to be negative for mycoplasma every 2–3 months using the MycoAlert Mycoplasma Detection Kit (Lonza).
-
bioRxiv - Genetics 2020Quote: ... hESCs were nucleofected with 2 μg of CRISPR and 3 μl ssODN (100 μm) using the P3 Primary Cell Kit L (Lonza). hESCs were then plated onto puromycin-resistant (DR4 ...
-
bioRxiv - Cell Biology 2020Quote: ... U–2–OS-pEP15 cells (5) were maintained in 1 mg/ml glucose phenol-red-free DMEM (Lonza) supplemented with steroid-free FBS (Thermo Fisher Scientific) ...
-
bioRxiv - Physiology 2023Quote: ... USA) were cultured in 5% fetal bovine serum containing endothelial cell growth medium (EGM-2; Lonza, Basel, Switzerland). Media was supplemented with heparin ...
-
bioRxiv - Cell Biology 2022Quote: ... One hundred microliters of adenylate kinase detection reagent (Lonza) were added to each well and the content was homogenized by gently pipetting up and down ...
-
bioRxiv - Bioengineering 2022Quote: ... GM-3TM Lymphocyte Growth Medium-3 (LGM-3™) (Lonza), Opti-MEM Serum-Free medium (Thermofisher) ...
-
bioRxiv - Developmental Biology 2021Quote: ... and 5 µg of PX459 gRNA vector (5’-GACTCCAGTCTTTCTAGAAGA-3’) were nucleofected with the AMAXA Mouse Embryonic Stem Cell Nucleofector Kit (LONZA, VPH-100) using program A-30 in the XRep ...
-
bioRxiv - Bioengineering 2019Quote: ... The plate containing the amplified genes or qPCR products was kept in ice and observed in a 2% agarose gel (NuSieve® 3:1 Agarose (Lonza)) to check and reinforce the identity of the amplicons ...
-
bioRxiv - Microbiology 2021Quote: ... HXGPRT amplicon (2-5 µg) into 1x106 RH TIR1-3FLAG tachyzoites in P3 buffer using a 4D-nucleofector (Lonza) with pulse code FI-158 ...
-
bioRxiv - Immunology 2022Quote: ... were coated overnight at 4°C with 25μL of SEC fractions 1 to 5 diluted 1:2 with PBS (Cat. No. LZBE17-512F, Lonza). Wells were washed with 0.05% Tween-20 (Cat ...
-
bioRxiv - Molecular Biology 2021Quote: ... and Alt-R™ HDR donor oligo 5’ GTGTTTAGAAAAAAAAGAGTGTTTTTTTACCAGGGCCTTTGGCTCTTCCAGGAAGCAGATGTCCGAGTCGGAATATAATAACCCTTTCATACTCTTG 3’ (PS modification, antisense; IDT) using a 4D-nucleofector System X Unit (Lonza, Basel, Switzerland) and the P3 primary Cell 4D-Nucleofector® X kit (#V4XP-3024 ...
-
bioRxiv - Cancer Biology 2024Quote: ... 1×106 T cells were transfected with Cas9/RNPs complexes of CD38 targeting guide RNA 5’-AGUGUAUGGGAUGCUUUCAA -3’ (Synthego) using Lonza 4D-Nucleofector™ X Unit (Lonza, AAF-1003X). Transfection was carried out in P3 Primary Cell 4D-Nucleofector™ Solution (Lonza ...