Labshake search
Citations for Lonza :
51 - 100 of 1557 citations for 5 2 3 Difluorophenyl 5 oxovaleric acid since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Bioengineering 2023Quote: ... in passages 5-8 were cultured at 37°C and 5% CO2 in EGM2 cell medium (Lonza). Cells were detached from the adhering surface using TrypLE (Life Technologies ...
-
bioRxiv - Microbiology 2021Quote: ... HXGPRT amplicon (2-5 µg) into 1x106 RH TIR1-3FLAG tachyzoites in P3 buffer using a 4D-nucleofector (Lonza) with pulse code FI-158 ...
-
bioRxiv - Immunology 2022Quote: ... were coated overnight at 4°C with 25μL of SEC fractions 1 to 5 diluted 1:2 with PBS (Cat. No. LZBE17-512F, Lonza). Wells were washed with 0.05% Tween-20 (Cat ...
-
bioRxiv - Microbiology 2021Quote: ... in Pro-CHO-5 media (Lonza, Switzerland).
-
bioRxiv - Neuroscience 2021Quote: ... and 5 U ml−1 Penstrep (Lonza). Hb9-GFP mouse stem cells were cultured as described (Wichterle et al ...
-
bioRxiv - Immunology 2021Quote: ... 5% CO2 in X-VIVO 15 (Lonza) supplemented with 5% (v/v ...
-
bioRxiv - Immunology 2022Quote: ... 5% CO2 culture medium (RMPI-1640 (Lonza) supplemented with 10% FBS (Gibco) ...
-
bioRxiv - Molecular Biology 2023Quote: ... supplemented with 5% human AB serum (Lonza), Interleukin-2 (50 ng/mL ...
-
bioRxiv - Developmental Biology 2021Quote: ... and 5 µg of PX459 gRNA vector (5’-GACTCCAGTCTTTCTAGAAGA-3’) were nucleofected with the AMAXA Mouse Embryonic Stem Cell Nucleofector Kit (LONZA, VPH-100) using program A-30 in the XRep ...
-
bioRxiv - Developmental Biology 2022Quote: Primary HDLECs were isolated from neonatal human foreskins as described previously (74) and cultured from passages 5 – 7 on fibronectin-coated plates with EGM-2 MV growth media (Lonza) supplemented with human VEGF-C (R&D) ...
-
bioRxiv - Immunology 2021Quote: Human telomerase-immortalized corneal epithelial (hTCEpi) cells (26) were maintained at 37°C/5% CO2 in regular keratinocyte growth medium KGM-2 (Lonza). Prior to treatment ...
-
bioRxiv - Immunology 2021Quote: ... CD3/CD28 beads were removed 48 hours after stimulation and 5 × 106 CTLs were electroporated with 2 μg plasmid using 4D-Nucleofector (Lonza). Medium was changed 6 hours after nucleofection and transfected cells were used 24-36 hours after electroporation ...
-
bioRxiv - Developmental Biology 2022Quote: ... Primary MEC were cultured in endothelial growth media (EGM) containing 5% FBS with growth factors (EBM-2; Lonza, Basel, Switzerland) at 37°C in 5% CO2 ...
-
bioRxiv - Cell Biology 2024Quote: ... cells (5×105/well in 6-well plates) were transfected with 2 μg of DNA by nucleofection using Amaxa device (Lonza) following manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2024Quote: ... cells were seeded on the fibronectin-coated Petri dish (TPP) and kept in the incubator (37 °C and 5% CO2) for 4-8 h in the EGM-2 (Lonza) containing 2% FBS ...
-
bioRxiv - Biochemistry 2020Quote: ... Fractions were pooled and buffer-exchanged to phosphate-buffered saline (PBS; 140 mM NaCl, 5 mM NaH2PO4, 5 mM Na2HPO4, pH 7.4; Lonza, UK) using a Sephadex G-25 column (GE Healthcare ...
-
bioRxiv - Biochemistry 2020Quote: ... Fractions were pooled and buffer-exchanged to phosphate-buffered saline (PBS; 140 mM NaCl, 5 mM NaH2PO4, 5 mM Na2HPO4, pH 7.4; Lonza, UK) using a Sephadex G-25 column (GE Healthcare ...
-
bioRxiv - Cancer Biology 2020Quote: ... The cells were dissociated into single cells with accutase and 1 million cells were used for nucleofection with 5 μg of gRNA/Cas9 plasmid and 5 μg of each donor plasmid (WT and G12D) using Nucleofector II (Lonza) and program B-16 ...
-
bioRxiv - Biochemistry 2020Quote: ... Fractions were pooled and buffer-exchanged to phosphate-buffered saline (PBS; 140 mM NaCl, 5 mM NaH2PO4, 5 mM Na2HPO4, pH 7.4; Lonza, UK) using a Sephadex G-25 column (GE Healthcare ...
-
bioRxiv - Microbiology 2021Quote: ... Fractions were pooled and buffer-exchanged to phosphate-buffered saline (PBS; 140 mM NaCl, 5 mM NaH2PO4, 5 mM Na2HPO4, pH 7.4; Lonza, UK) using Sephadex G-25 media (GE Healthcare ...
-
bioRxiv - Biochemistry 2020Quote: ... Fractions were pooled and buffer-exchanged to phosphate-buffered saline (PBS; 140 mM NaCl, 5 mM NaH2PO4, 5 mM Na2HPO4, pH 7.4; Lonza, UK) using a Sephadex G-25 column (GE Healthcare ...
-
bioRxiv - Neuroscience 2024Quote: ... 2.5 × 10 5 phNPCs cells were used per electroporation reaction in one cuvette of the 16-well Nucleocuvette Stripe (Lonza). After trypsinization ...
-
bioRxiv - Cell Biology 2022Quote: ... the mammary glands were digested overnight at 37 ºC and 5% CO2 in a loosely capped 50 ml falcon with 5 ml of DMEM/F12 (Lonza) supplemented with 25 mM HEPES ...
-
bioRxiv - Molecular Biology 2021Quote: ... and Alt-R™ HDR donor oligo 5’ GTGTTTAGAAAAAAAAGAGTGTTTTTTTACCAGGGCCTTTGGCTCTTCCAGGAAGCAGATGTCCGAGTCGGAATATAATAACCCTTTCATACTCTTG 3’ (PS modification, antisense; IDT) using a 4D-nucleofector System X Unit (Lonza, Basel, Switzerland) and the P3 primary Cell 4D-Nucleofector® X kit (#V4XP-3024 ...
-
bioRxiv - Cancer Biology 2024Quote: ... 1×106 T cells were transfected with Cas9/RNPs complexes of CD38 targeting guide RNA 5’-AGUGUAUGGGAUGCUUUCAA -3’ (Synthego) using Lonza 4D-Nucleofector™ X Unit (Lonza, AAF-1003X). Transfection was carried out in P3 Primary Cell 4D-Nucleofector™ Solution (Lonza ...
-
bioRxiv - Developmental Biology 2020Quote: ... completed with 5% fetal bovine serum (FBS, Lonza) and 2mM L-glutamine (Sigma-Aldrich) ...
-
bioRxiv - Microbiology 2023Quote: ... with a final concentration of 2% formaldehyde and 2% NuSieve 3:1 agarose (Lonza). 5 µg RNA was denatured for 10 min at 70 °C with 1 X MOPS buffer (20 mM MOPS ...
-
bioRxiv - Cell Biology 2022Quote: ... Cells were maintained at 37°C in 5% CO2 in either EGM-2 MV complete media (CC-3125, Lonza, Walkersville, MD) or in M199 supplemented with 20% FBS (Atlanta Biologicals ...
-
bioRxiv - Bioengineering 2022Quote: ... for 1.5 h at 37°C and 5% CO2 before seeded with human umbilical vein endothelial cells (HUVECs, pooled donor, Lonza, Switzerland). Endothelial Cell Growth Medium-2 (EGM-2 ...
-
bioRxiv - Microbiology 2024Quote: ... 4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid (HEPES) 25 mM (Lonza, 17-737F), gentamicin 25 μg/ml (Lonza ...
-
bioRxiv - Microbiology 2021Quote: ... treated with 5 ml of ACK lysing buffer (Lonza), and frozen with 3ml of Bambanker freezing media ...
-
bioRxiv - Cell Biology 2022Quote: ... 5 μL of 200× SYBR Green I (Lonza, Switzerland) was added to 200 μL of the diluted culture for a final concentration of 5× SYBR Green I ...
-
bioRxiv - Microbiology 2021Quote: ... treated with 5 ml of ACK lysing buffer (Lonza), and frozen with 3ml of Bambanker freezing media ...
-
bioRxiv - Microbiology 2022Quote: ... treated with 5 ml of ACK lysing buffer (Lonza), and frozen with 3 ml of Bambanker freezing media ...
-
bioRxiv - Cancer Biology 2023Quote: ... incubated with 5 ml of 0.5 mM EDTA (Lonza) at 37° C for 2 minutes to detach the cells ...
-
bioRxiv - Systems Biology 2023Quote: ... 5% CO2 in 1:1 RPMI:MEGM (Lonza, #CC-3151), 3% fetal bovine serum (FBS,Gibco) ...
-
bioRxiv - Bioengineering 2023Quote: ... 1X (5 mL) of L-glutamine (Lonza, 17-605E), and 1X (5 mL ...
-
bioRxiv - Physiology 2024Quote: ... containing microvascular SingleQuots Supplement Pack in 5% FBS (Lonza). Cells were studied after 12-14 days of differentiation at 37°C and were free of Mycoplasma infection ...
-
bioRxiv - Physiology 2024Quote: ... supplemented with 5% fetal bovine serum (Lonza, Basel, Switzerland) at 37°C in a 5% CO2 atmosphere ...
-
bioRxiv - Cell Biology 2022Quote: ... and CD31+Rspo3+ cells were centrifuged at 500 g for 5 min and resuspended in 500 μl endothelial cell media: EGM-2 MV Bullet Kit (Lonza, cc-3202) supplemented with 50 ng/mL VEGF-C (R&D ...
-
bioRxiv - Cell Biology 2024Quote: ... Cells were grown at 37°C with 5%CO2 using EGM-2 medium supplemented with SingleQuots from Lonza (CC-3156 & CC-4176). Cells were passaged using 0.25% trypsin EDTA every 2–3 days ...
-
bioRxiv - Bioengineering 2023Quote: ... in 6-well tissue culture plates and were allowed to adhere for 5 hours before induction of serum starvation in EBM-2 (LONZA, Cat# CC-3156) for 16 hours prior to being administered media of interest ...
-
bioRxiv - Neuroscience 2020Quote: ... 6 µg of total plasmid DNA (2 µg for each of the three episomal vectors) were electroporated into 5×10^5 fibroblasts with the Amaxaμ Human Dermal Fibroblast Nucleofectorμ Kit (Lonza, Basel, Switzerland; VDP-1001). The fibroblasts were further cultured for 6 days to allow them to recover ...
-
bioRxiv - Cell Biology 2022Quote: ... the PBS was removed and 3 mL of SkBM-2 (Lonza) media was added to each chamber ...
-
bioRxiv - Bioengineering 2021Quote: ... 5 % CO2 incubator in SmGM− growth medium (Lonza, Basel, Switzerland). The SMCs were passaged at 70 – 80 % confluency ...
-
bioRxiv - Bioengineering 2020Quote: ... and P3-5 human dermal fibroblasts (HDFs, Lonza CC-2509) were dissociated ...
-
bioRxiv - Developmental Biology 2020Quote: Passage 5 Human Umbilical Vein ECs (HUVECS) (Lonza, CC-2517) were used for the in vitro experiments ...
-
bioRxiv - Molecular Biology 2020Quote: ... and 5% (V/V) FCS (LO CC-3202/6, Lonza) up to 70-75% confluency ...
-
bioRxiv - Immunology 2021Quote: ... or an electroporation cartridge (100 µl = 5×106 cells, Lonza). Cells were carefully transferred onto the electroporation strips using 200 µl tips to avoid trapping air in the solution ...
-
bioRxiv - Developmental Biology 2023Quote: ... 5 ml 100x L-glutamine (200 nM) (Lonza #BE17-605E), 5 mL 100x penicillin (5000 U/ml)/ streptomycin (5000 μg/ml) ...