Labshake search
Citations for Lonza :
51 - 100 of 1674 citations for 3 2 5 Dioxoimidazolidin 4 yl propanoic acid since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2022Quote: ... for 4 days with complete EGM-2 media (Lonza CC-4147, Lonza CC-3156). Upon reaching 80-90% confluence ...
-
bioRxiv - Physiology 2022Quote: ... (5 g/L trypsin and 2 g/L EDTA diluted 1 in 5 in calcium- and magnesium-free PBS) (Lonza, UK).
-
bioRxiv - Cell Biology 2024Quote: ... prepared in tris-acetate (40 mM)/EDTA (10 mM) buffer and 5 μl of GelStar Nucleic Acid Stain 10,000 x (Lonza, 50535). 20 μl per sample resulting from PCR were mixed with Blue/Orange loading buffer loading dye 6x (PROMEGA ...
-
bioRxiv - Immunology 2022Quote: ... puromycin containing medium were changed and every 4 days cells were fed EGM™-2 Endothelial Cell Growth Medium-2 BulletKit™ (LONZA) supplemented with GlutaMax (ThermoFisher ...
-
bioRxiv - Cancer Biology 2021Quote: Primary human lung microvascular endothelial cells (HMVEC-L) were seeded at 5000 cells/cm2 in EBM-2 with 5% FBS and EGM-2 supplement (all products, Lonza Bioscience) until reaching complete confluence 14 ...
-
bioRxiv - Immunology 2023Quote: ... MEFs were allowed to expand for 2-3 days before harvest with 0.05% trypsin-EDTA (Lonza). iBMDMs were immortalized with J2 virus to generate iBMDMs.
-
bioRxiv - Cell Biology 2022Quote: ... Electroporation with the CA-137 program was performed 3-5 min after this addition (Lonza Group AG). Following this ...
-
bioRxiv - Molecular Biology 2021Quote: Inguinal white adipose tissue from 3-4 WT-C57Bl/6 male mice was collected and placed in Dulbecco’s modified eagle’s medium (DMEM; Lonza) supplemented with 1% Penicillin/Streptomycin (PS ...
-
bioRxiv - Immunology 2021Quote: ... coated dishes (5 ng/cm2) and cultured in Endothelial Growth Medium 2 (EGM2, Lonza) supplemented with 50 ng/mL VEGF with medium changes every other day until they reached confluency ...
-
bioRxiv - Bioengineering 2024Quote: ... were cultured on a 0.1% gelatin-coated tissue culture dish at 37°C and 5% CO2 in Endothelial Cell Growth Medium - 2(EGM-2, Lonza, Basel, CH). HUVECs were transduced with mCherry lentiviral pseudovirus (pCDH-CMV-mCherry-T2A-Puro ...
-
bioRxiv - Microbiology 2024Quote: ... nonessential amino acids (Lonza), penicillin (100 IU/ml) ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... droplets in 6 well plates and treated with retinoic acid for 4 days followed by hepatocyte growth media (Hepatocyte Culture Medium BulletKit (Lonza, CC-3198) supplemented with 10 ng/mL hepatocyte growth factor (PeproTech ...
-
bioRxiv - Neuroscience 2021Quote: ... Tissues were washed 3-4 times over 1 hour in PBS (calcium- and magnesium-free; Lonza BioWhittaker #17-517Q) containing 0.1% Triton X-100 (PBT ...
-
bioRxiv - Cancer Biology 2023Quote: ... Regular testing for mycoplasma contamination was conducted every 3-4 weeks using the MycoAlert PLUS mycoplasma detection kit (Lonza).
-
bioRxiv - Cell Biology 2021Quote: ... Passaging of iPSCs was carried out every 4-5 days using Versene (EDTA 0.02%) (Lonza, BE17–771E) solution for 3–5⍰minutes at 37⍰°C ...
-
bioRxiv - Cell Biology 2023Quote: ... cultured for 48 h at 37°C with 5% CO2 in EGM™-2 Endothelial Cell Growth Medium-2 BulletKit™ (Lonza, UK) with penicillin–streptomycin (100_U/ml ...
-
bioRxiv - Cell Biology 2023Quote: ... cultured for 48 h at 37°C with 5% CO2 in EGM™-2 Endothelial Cell Growth Medium-2 BulletKit™ (Lonza, UK) with penicillin–streptomycin (100_U/ml ...
-
bioRxiv - Cell Biology 2024Quote: ... The cells were used from passages 5-9 for the experiments and were cultured in endothelial cell growth Medium-2 (EGM™-2) Bulletkit™ (Lonza Bioscience) on pretreated tissue culture 6-well plate (VWR international) ...
-
bioRxiv - Cancer Biology 2024Quote: ... were incubated at 37°C/5%CO2 and supplemented in 10% FBS and EGM™-2 Endothelial Cell Growth Medium-2 BulletKit™ (Lonza, Switzerland). HUVECs and all other cancer cell lines were sub-cultured as adherent cells every 2-3 days.
-
bioRxiv - Genomics 2020Quote: ... S2 cells were seeded at 2×106 per 6cm plate in 4 mL S2 medium (Lonza). One hour after plating ...
-
bioRxiv - Bioengineering 2023Quote: ... 2×109 Freestyle CHO-S cells were resuspended in 500ml ProCHO 4 Protein-free Medium (Lonza, Cat#BEBP12-029 ...
-
bioRxiv - Bioengineering 2024Quote: ... were cultured for a maximum of 4 passages cultured in EGM™-2 (Lonza #CC-4176) in T-175 or T-75 culture flasks (Thermo ...
-
bioRxiv - Bioengineering 2024Quote: ... with L-ascorbic acid-2-phosphate (AA2P) (5mg/ml stock, 10 µl/ml), and β-glycerolphosphate (BGP) (20 mM stock, 20 µl/ml) (Lonza). The cell culture medium was changed every 3 days ...
-
bioRxiv - Cell Biology 2021Quote: ... siRNA directed against Dsg1 (Integrated DNA Technologies) with a targeting sequence 5′-CCATTAGAGAGTGGCAATAGGATGA-3′ using Amaxa Nucleofector System (Lonza) for electroporation of cells according to manufacturer’s instructions.
-
bioRxiv - Neuroscience 2024Quote: ... and 300μM single stranded oligodeoxynucleotides (ssODN: 5’gggtccagggtggctgtcactcat ccttttttctggctaccaaaggtgcagataattaaGaagaagctggatcttagcaacgtccagccaagtgtggctcaaaggataatatc aaacacgtcc 3’) and the P3 Primary Cell 4D reaction mix (Lonza). We screened a minimum of 96 clones for genetic editing ...
-
bioRxiv - Molecular Biology 2020Quote: ... at Day 3-4 of phase I culture were electroporated using P3 Primary Cell 4D NucleofectorTM X Kit (from Lonza) with program DZ100 (Bak et al. ...
-
bioRxiv - Immunology 2021Quote: ... 2.106 T cells were resuspended in 20 µl of nucleofection solution with 3 µl or 4 µl RNP and transferred to Nucleofection cuvette strips (4D-Nucleofector X kit S; Lonza). Murine T cells were electroporated using the DN110 program of 4D nucleofector (4D-Nucleofector Core Unit ...
-
bioRxiv - Cell Biology 2021Quote: ... were isolated from healthy donors (n=3) as described[4] and seeded on 6 cm dishes within BEGM media (Lonza) before transduction with lentivirus (empty vector (Origene ...
-
bioRxiv - Cell Biology 2024Quote: ... Cells were passaged 1:10 every 3-4 days by trypsinisation and were regularly screened for mycoplasma contamination (Mycoalert, Lonza).
-
bioRxiv - Evolutionary Biology 2020Quote: ... non-essential amino acids (Lonza), 10 percent heat-inactivated FBS (GE Healthcare Bio-Sciences) ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... non-essential amino acids (Lonza), and 10 percent heat-inactivated FBS (Hyclone) ...
-
bioRxiv - Immunology 2021Quote: ... 1% nonessential amino acids (Lonza), 1 mM sodium pyruvate (Gibco ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... non-essential amino acids (Lonza), and 10% heat-inactivated FBS (Hyclone).
-
bioRxiv - Microbiology 2020Quote: ... 1x nonessential amino acids (Lonza) and 20 µg ml-1 trypsin (Lonza) ...
-
bioRxiv - Immunology 2022Quote: ... amino acid (NEAA 100x Lonza) and Penicillin-Streptomycin (Gibco ...
-
bioRxiv - Physiology 2022Quote: ... ascorbic acid (CC-4116C, Lonza), bovine brain extract (CC-4092C ...
-
bioRxiv - Molecular Biology 2022Quote: ... ascorbic acid (#CC-4116C, Lonza), bovine brain extract (#CC-4092C ...
-
bioRxiv - Biochemistry 2023Quote: ... 1% 1xnonessential amino acids (Lonza), 50 μM 2-mercaptoethanol ...
-
bioRxiv - Cell Biology 2023Quote: ... non-essential amino acids (Lonza) and leukaemia inhibitory factor (1000 U/ml ...
-
bioRxiv - Cell Biology 2020Quote: ... expanded over 5-6 days of culture in EGM-2-medium (Lonza, CC-3156, CC-4176). Medium was aspirated and replaced by pre-warmed 10 mL serum-free EGM-2-medium per 10 cm/dish ...
-
bioRxiv - Immunology 2022Quote: Cryopreserved PBMC (2-5 × 106/sample) were thawed in prewarmed RPMI-1640 with L-glutamine (Lonza) + 10% FCS ...
-
bioRxiv - Cell Biology 2021Quote: ... 2 and 5 were isolated from human nonparenchymal liver cells (NPCs) purchased from Lonza (cat# HUCNP) as described previously (Chen et al. ...
-
bioRxiv - Cell Biology 2020Quote: ... expanded over 5-6 days of culture in EGM-2-medium (Lonza, CC-3156, CC-4176). Medium was aspirated and replaced by pre-warmed 10 mL serum-free EGM-2-medium per 10 cm/dish ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... Sf9 cells (4 × 105 cells* ml) in 2 ml of Insect-Xpress medium (Lonza, Walkersville, MD, USA) were transfected with recombinant bacmids using Cellfectin reagent (Life Technologies) ...
-
bioRxiv - Cell Biology 2022Quote: ... ∼2-4 million cells were electroporated using the T020 method of the Nucleofector™ 2b device (Lonza). Immediately after electroporation ...
-
bioRxiv - Biochemistry 2023Quote: ... ∼2-4 million cells were electroporated using the T020 method of the Nucleofector™ 2b device (Lonza). Immediately after electroporation ...
-
bioRxiv - Developmental Biology 2023Quote: iPSCs were transfected with sgRNA 3’ UCCCUUUCCUCAGGUCACAG 5’ (Synthego) via nucleofection using program CA137 on a 4D Nucleofactor X (Lonza) as per manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2021Quote: ... Human primary hepatic stellate cells from donors 3 and 4 were purchased as isolated hepatic stellate cells from Lonza (cat# HUCLS). Donor information is listed below.
-
bioRxiv - Developmental Biology 2021Quote: ... HESCs were transfected with a total of 4ug DNA in a ratio 2:3 (gRNAs:donor template) using the Amaxa P3 Primary Cell 4D-Nucleofector Kit (Lonza). Puromycin was added 3 days after electroporation at a concentration of 0.5ug/ml ...
-
bioRxiv - Cell Biology 2022Quote: Human umbilical vein endothelial cells (HUVEC) were cultured between passage 3 and 6 in EGM-2 complete medium (Lonza)3,52–55 ...