Labshake search
Citations for Lonza :
51 - 100 of 2172 citations for 1 2 Bromoethoxy 3 5 dimethylbenzene 97+% since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2020Quote: ... expanded over 5-6 days of culture in EGM-2-medium (Lonza, CC-3156, CC-4176). Medium was aspirated and replaced by pre-warmed 10 mL serum-free EGM-2-medium per 10 cm/dish ...
-
bioRxiv - Immunology 2022Quote: Cryopreserved PBMC (2-5 × 106/sample) were thawed in prewarmed RPMI-1640 with L-glutamine (Lonza) + 10% FCS ...
-
bioRxiv - Cell Biology 2021Quote: ... 2 and 5 were isolated from human nonparenchymal liver cells (NPCs) purchased from Lonza (cat# HUCNP) as described previously (Chen et al. ...
-
bioRxiv - Cell Biology 2020Quote: ... expanded over 5-6 days of culture in EGM-2-medium (Lonza, CC-3156, CC-4176). Medium was aspirated and replaced by pre-warmed 10 mL serum-free EGM-2-medium per 10 cm/dish ...
-
bioRxiv - Developmental Biology 2021Quote: ... The resulting mixture was electrophoresed in NuSieve 3:1 agarose (Lonza 50091), and fragments sized 150-350 bp were excised and then purified using a MinElute Gel Extraction kit (QIAGEN 28604) ...
-
bioRxiv - Microbiology 2021Quote: ... cells were overlaid with 1:1 mixture of 2% agarose (Lonza, Basel, Switzerland) and 2X MEM medium ...
-
bioRxiv - Genetics 2020Quote: ... ∼1×106 cells were transfected with pairs of 5 µg gRNA plasmid and 4 µg ssODN (Supplementary Table 3) using AmaxaTM Human CD34 Cell NucleofectorTM Kit (Lonza) in the 2B-NucleofectorTM on the U-08 setting ...
-
bioRxiv - Developmental Biology 2023Quote: iPSCs were transfected with sgRNA 3’ UCCCUUUCCUCAGGUCACAG 5’ (Synthego) via nucleofection using program CA137 on a 4D Nucleofactor X (Lonza) as per manufacturer’s instructions ...
-
bioRxiv - Developmental Biology 2021Quote: ... HESCs were transfected with a total of 4ug DNA in a ratio 2:3 (gRNAs:donor template) using the Amaxa P3 Primary Cell 4D-Nucleofector Kit (Lonza). Puromycin was added 3 days after electroporation at a concentration of 0.5ug/ml ...
-
bioRxiv - Cancer Biology 2024Quote: ... and (iv) the NDF-2 and NDF-3 cell lines (human neonatal dermal fibroblast cell lines, #CC-2509; Lonza Bioscience ...
-
bioRxiv - Cell Biology 2022Quote: Human umbilical vein endothelial cells (HUVEC) were cultured between passage 3 and 6 in EGM-2 complete medium (Lonza)3,52–55 ...
-
bioRxiv - Bioengineering 2024Quote: ... The hUVEC cells were cultured and expanded until passage 5 with EGM-2 media (CC-3156, Lonza) and SingleQuot supplements (CC-4176 ...
-
bioRxiv - Biochemistry 2024Quote: ... Cells were split at a 1:2 ratio every 2 days by trypsinization (Lonza cat# CC-5012), followed by centrifugation at 200 x g for 3 min before resuspending and reseeding in EBM Basal Medium supplemented with the EGM Singlequots Supplement Pack ...
-
bioRxiv - Cell Biology 2022Quote: ... All cell lines were tested to be negative for mycoplasma every 2–3 months using the MycoAlert Mycoplasma Detection Kit (Lonza).
-
bioRxiv - Genetics 2020Quote: ... hESCs were nucleofected with 2 μg of CRISPR and 3 μl ssODN (100 μm) using the P3 Primary Cell Kit L (Lonza). hESCs were then plated onto puromycin-resistant (DR4 ...
-
bioRxiv - Physiology 2023Quote: ... USA) were cultured in 5% fetal bovine serum containing endothelial cell growth medium (EGM-2; Lonza, Basel, Switzerland). Media was supplemented with heparin ...
-
bioRxiv - Cell Biology 2022Quote: ... BUB-1 and CLS-2::GFP production was performed in 2 L SF9 cells in Insect-XPRESS (Lonza) medium (1×10^6 cells/mL) ...
-
bioRxiv - Bioengineering 2022Quote: ... GM-3TM Lymphocyte Growth Medium-3 (LGM-3™) (Lonza), Opti-MEM Serum-Free medium (Thermofisher) ...
-
bioRxiv - Developmental Biology 2021Quote: ... and 5 µg of PX459 gRNA vector (5’-GACTCCAGTCTTTCTAGAAGA-3’) were nucleofected with the AMAXA Mouse Embryonic Stem Cell Nucleofector Kit (LONZA, VPH-100) using program A-30 in the XRep ...
-
Measuring adaptation dynamics to hydrogen peroxide in single human cells using fluorescent reportersbioRxiv - Cell Biology 2020Quote: ... 1% L-glutamine (2 mM) and 1% (v/v) penicillin-streptomycin (100 IU/ml) (Lonza). Cell cultures are maintained at 37°C in a humidified atmosphere containing 5 % CO2 (v/v) ...
-
bioRxiv - Cancer Biology 2023Quote: ... 2×10E6 ME-1 cells were nucleofected with CRISPR/Cas9 plasmids (2 μg each) using Nucleofector Technology (Lonza Biologics) with the program X-01 and Amaxa Cell Line Nucleofector Kit V ...
-
bioRxiv - Developmental Biology 2023Quote: ... MVECs were expanded and grown on 1% gelatin-coated dishes in endothelial basal medium-2 (EBM-2 (Lonza; 3156) with 10 % heat-inactivated FBS (Gibco) ...
-
bioRxiv - Microbiology 2021Quote: ... HXGPRT amplicon (2-5 µg) into 1x106 RH TIR1-3FLAG tachyzoites in P3 buffer using a 4D-nucleofector (Lonza) with pulse code FI-158 ...
-
bioRxiv - Molecular Biology 2021Quote: ... and Alt-R™ HDR donor oligo 5’ GTGTTTAGAAAAAAAAGAGTGTTTTTTTACCAGGGCCTTTGGCTCTTCCAGGAAGCAGATGTCCGAGTCGGAATATAATAACCCTTTCATACTCTTG 3’ (PS modification, antisense; IDT) using a 4D-nucleofector System X Unit (Lonza, Basel, Switzerland) and the P3 primary Cell 4D-Nucleofector® X kit (#V4XP-3024 ...
-
bioRxiv - Cancer Biology 2024Quote: ... 1×106 T cells were transfected with Cas9/RNPs complexes of CD38 targeting guide RNA 5’-AGUGUAUGGGAUGCUUUCAA -3’ (Synthego) using Lonza 4D-Nucleofector™ X Unit (Lonza, AAF-1003X). Transfection was carried out in P3 Primary Cell 4D-Nucleofector™ Solution (Lonza ...
-
bioRxiv - Cell Biology 2020Quote: ... Cells in passage 1 were trypsinized and resuspended (3 × 104 cells/mL) in BEGM** (Lonza, see Table S4 for details of media composition ...
-
bioRxiv - Biochemistry 2023Quote: ... Cells were regularly passaged 2-3 times a week and routinely tested for mycoplasma contamination using MycoAlert Plus mycoplasma Detection kit (Lonza, #LT07-710).
-
bioRxiv - Cancer Biology 2021Quote: ... Stable LBH-overexpressing BT549 cell lines were generated by nucleofection of 2×106 BT549 cells with 2 μg linearized pCDNA3 or pCDNA3+Lbh 13 and 1 μg pEGFP (Lonza) in Solution V (Lonza) ...
-
bioRxiv - Immunology 2021Quote: ... HUVEC cells were cultured on a 1% gelatin coated surface in EGMTM-2 Endothelial Cell Growth Medium-2 BulletKitTM (Lonza) following the manufacturer’s instructions with an additional 6% FBS ...
-
Cancer-associated fibroblasts produce matrix-bound vesicles that influence endothelial cell functionbioRxiv - Cancer Biology 2023Quote: ... HUVECs and HMVECs were cultured on 1% gelatin coated dishes in EGM-2 or EGM-2 MV (Lonza, Basel, Switzerland), respectively ...
-
bioRxiv - Neuroscience 2024Quote: ... 2 mg Cas9-gRNA-2 plasmid and 1 mg eGFP-puromycin resistance plasmid using the Amaxa 4D-Nucleofector system (Lonza) according to the manufacturer’s instructions with a pulse load of CA137 ...
-
bioRxiv - Developmental Biology 2022Quote: Primary HDLECs were isolated from neonatal human foreskins as described previously (74) and cultured from passages 5 – 7 on fibronectin-coated plates with EGM-2 MV growth media (Lonza) supplemented with human VEGF-C (R&D) ...
-
bioRxiv - Immunology 2021Quote: Human telomerase-immortalized corneal epithelial (hTCEpi) cells (26) were maintained at 37°C/5% CO2 in regular keratinocyte growth medium KGM-2 (Lonza). Prior to treatment ...
-
bioRxiv - Immunology 2021Quote: ... CD3/CD28 beads were removed 48 hours after stimulation and 5 × 106 CTLs were electroporated with 2 μg plasmid using 4D-Nucleofector (Lonza). Medium was changed 6 hours after nucleofection and transfected cells were used 24-36 hours after electroporation ...
-
bioRxiv - Developmental Biology 2022Quote: ... Primary MEC were cultured in endothelial growth media (EGM) containing 5% FBS with growth factors (EBM-2; Lonza, Basel, Switzerland) at 37°C in 5% CO2 ...
-
bioRxiv - Cell Biology 2024Quote: ... cells (5×105/well in 6-well plates) were transfected with 2 μg of DNA by nucleofection using Amaxa device (Lonza) following manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2024Quote: ... cells were seeded on the fibronectin-coated Petri dish (TPP) and kept in the incubator (37 °C and 5% CO2) for 4-8 h in the EGM-2 (Lonza) containing 2% FBS ...
-
bioRxiv - Cancer Biology 2023Quote: ... the cell pellet was resuspended in 1-5 ml ACK lysis buffer (Lonza), according to the pellet size ...
-
bioRxiv - Bioengineering 2020Quote: ... The cell suspension contained a 2:1 ratio of GFP-HUVECs (Lonza) and HDFs ...
-
bioRxiv - Microbiology 2024Quote: ... 4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid (HEPES) 25 mM (Lonza, 17-737F), gentamicin 25 μg/ml (Lonza ...
-
bioRxiv - Molecular Biology 2024Quote: ... ∼300 pairs of ovaries were dissected from 3-6 day old females in 1× PBS (Lonza) with 1 mM DTT (Sigma ...
-
bioRxiv - Synthetic Biology 2021Quote: ... Isolated NK cells were activated at 1 x 106 cells mL-1 for 5 days in XVivo15 medium (Lonza) with 5% fetal bovine serum ...
-
bioRxiv - Cell Biology 2022Quote: ... Cells were maintained at 37°C in 5% CO2 in either EGM-2 MV complete media (CC-3125, Lonza, Walkersville, MD) or in M199 supplemented with 20% FBS (Atlanta Biologicals ...
-
bioRxiv - Cell Biology 2024Quote: ... These cells are mantained in 30% FBS/1% antibiotic/antimycotic /1% Non-essential AA/ EGM-2 media (Lonza) with Laminin521 coating (5 μg/ml ...
-
bioRxiv - Genomics 2020Quote: ... The first consisted of 2 μl/well pmaxGFP DNA (LONZA,1 μg/ul) diluted in 250 μl/well Opti-MEM® medium (ThermoFisher Scientific ...
-
bioRxiv - Cell Biology 2020Quote: ... and 8 × 105 cells were electroporated using 5 mg of total DNA (Ratio 1:1) and the Amaxa Nucleofector kit (Lonza) as described (Ran et al. ...
-
bioRxiv - Genetics 2024Quote: ... Cells were cultured at 37°C in a humidified atmosphere and 5% CO2 in a 1:1 mixture of DMEM (Lonza) and Ham’s F10 (Lonza ...
-
bioRxiv - Cell Biology 2022Quote: ... and CD31+Rspo3+ cells were centrifuged at 500 g for 5 min and resuspended in 500 μl endothelial cell media: EGM-2 MV Bullet Kit (Lonza, cc-3202) supplemented with 50 ng/mL VEGF-C (R&D ...
-
bioRxiv - Cell Biology 2024Quote: ... Cells were grown at 37°C with 5%CO2 using EGM-2 medium supplemented with SingleQuots from Lonza (CC-3156 & CC-4176). Cells were passaged using 0.25% trypsin EDTA every 2–3 days ...
-
bioRxiv - Bioengineering 2020Quote: ... Fluidic lines were coated with 1% gelatin which was replaced by EGM-2 (Lonza) for up to 24 hours ...