Labshake search
Citations for Lonza :
901 - 950 of 3154 citations for Human Eukaryotic Translation Initiation Factor 4E Binding Protein 1 EIF4EBP1 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genetics 2021Quote: ... RNPs containing recombinant CRISPR/Cas9 and sgRNA were transfected to human cell lines using a Nucleofector (Lonza). Stable cell lines were generated by selection of hygrogmycin resistance ...
-
bioRxiv - Immunology 2021Quote: ... were expanded in 75 cm2 tissue culture flasks using human endothelial cell growth medium (Lonza, CC-3202) until 70-80% confluent.
-
bioRxiv - Developmental Biology 2019Quote: ... The human Atoh8 expression plasmid [30] was transfected by electropulsing using the Cell Line Nucleofector System (Lonza) following standard procedures provided by the manufacturers.
-
bioRxiv - Cell Biology 2019Quote: ... MCF10A (human breast epithelial cell line) were cultured in Mammary Epithelial Cell Growth Medium (Lonza, CC-3151) with supplements and growth factors (Lonza ...
-
bioRxiv - Synthetic Biology 2021Quote: ... T cells were cultured in human T cell medium consisting of X-VIVO 15 (Lonza #04-418Q), 5% Human AB serum and 10 mM neutralized N-acetyl L-Cysteine (Sigma-Aldrich #A9165 ...
-
bioRxiv - Bioengineering 2021Quote: Human bone marrow-derived MSCs were obtained from 4 different donors purchased from Lonza (Walkersville, MD, USA), AllCells (Emeryville ...
-
bioRxiv - Bioengineering 2021Quote: Human umbilical vein endothelial cells (ECs) were cultured in endothelial growth medium (EGM-2; Lonza, Basel, Switzerland) supplemented with 1% penicillin-streptomycin-fungizone (Gibco ...
-
bioRxiv - Synthetic Biology 2021Quote: ... T cells were cultured in human T cell medium consisting of X-VIVO 15 (Lonza #04-418Q), 5% Human AB serum and 10 mM neutralized N-acetyl L-Cysteine (Sigma-Aldrich #A9165 ...
-
bioRxiv - Biophysics 2020Quote: Human mesenchymal stem cells (PT-2501) used for proof-of-principle dSTORM imaging were purchased from Lonza Group ...
-
bioRxiv - Cell Biology 2021Quote: HEK293 (human embryonic kidney 293) cells were grown in Dulbeccos Modified Eagles Medium (DMEM, Lonza, Basel, Switzerland) supplemented with 10% (v/v ...
-
bioRxiv - Microbiology 2021Quote: ... whereas human monocyte cell line U937 (ATCC CRL-1593.2) was maintained in complete RPMI 1640 media (Lonza) with 100 µM β-mercaptoethanol and differentiated to macrophages using 20 ng/ml PMA for 24 hours prior to infection ...
-
bioRxiv - Biochemistry 2022Quote: Human Aortic Endothelial Cells (HAEC) derived from two the same age male donors were purchased from Lonza. Cells were grown in Endothelial Cell Growth Medium BulletKit®-2 (EGM-2 BulletKit ...
-
bioRxiv - Neuroscience 2020Quote: ... Me49-Luc tachyzoites were maintained in vitro in monolayers of Normal Human Dermal Fibroblasts-Neonatal (NHDF, Lonza; kindly provided by Dr ...
-
bioRxiv - Developmental Biology 2019Quote: Human umbilical vein endothelial cells (HUVECs) were maintained in supplemented EGM2 medium (EGM2 Bulletkit, K3CC-3162 Lonza). Cells were transduced on suspension at a multiplicity of infection (m.o.i. ...
-
bioRxiv - Cancer Biology 2019Quote: Human umbilical endothelial vein cells (HUVEC) were serum-starved overnight in EGM-2 media (Lonza, CC-3162) containing 0.2% FBS ...
-
bioRxiv - Microbiology 2021Quote: Normal human bronchial epithelial (NHBE) cells (donor 41219) were purchased from Lonza (Walkersville, MD Cat# CC-2540) and maintained in Bronchial Epithelial Cell Growth Medium (BEGM ...
-
bioRxiv - Cancer Biology 2019Quote: ... Human umbilical vein endothelial cells (HUVEC) were grown in endothelial cells growth medium-2 (EGM-2) (Lonza). All cells were cultured at 37◻°C and 5% CO2 in incubator cells.
-
bioRxiv - Physiology 2021Quote: ... healthy human and diabetic patient coronary artery endothelial cells (Healthy and Diabetic hCEC) were purchased from Lonza. The cells were cultured in the medium supplied from the companies as instructed ...
-
bioRxiv - Cell Biology 2020Quote: ... Primary human pulmonary arterial smooth muscle cells (PASMCs) were cultured in SmGM-2 cell culture media (Lonza), and experiments were performed at passages 3 to 9 ...
-
bioRxiv - Biophysics 2023Quote: the first cell lineage (named ASMC_1 onwards) is a commercial immortalized human ASMCs lineage purchased from Lonza and delivered at passage 3 ...
-
bioRxiv - Microbiology 2023Quote: Caco-2 cells (human intestinal epithelial cell line) were cultured in DMEM - Dulbecco’s Modified Eagle Medium (Lonza) supplemented with 10% FBS (Gibco) ...
-
bioRxiv - Cancer Biology 2023Quote: Human breast adipose tissue was incubated in mammary epithelial cell growth base medium (MEBM) (Lonza #cc-3151) supplemented with 0.5% bovine serum albumin (BSA ...
-
bioRxiv - Synthetic Biology 2024Quote: ... T cells were cultured in human T cell medium consisting of X-VIVO 15 (Lonza #04-418Q), 5% Human AB serum and 10 mM neutralized N-acetyl L-Cysteine (Sigma-Aldrich #A9165 ...
-
bioRxiv - Microbiology 2020Quote: ... the RNP complexes were added to 1×105 cells in 40 μl of P3 nucleofection buffer from the 4D-Nucleofector X kit (Lonza). Half of the mixture was loaded to each well of a 16-well nucleofection cassette and nucleofected using the using E0-100 program with the 4D-Nucleofector Lonza Amaxa ...
-
bioRxiv - Immunology 2021Quote: Control or transfected Lymphocytes (with Flag-wt-TDP-43 or Flag-NLS-mut-TDP-43 plasmid (1 μg) using nucleofection kit (Lonza)) were placed on coverslips (2 x 106 cells in sterile glass coverslips-Ø 12 mm ...
-
bioRxiv - Genomics 2020Quote: 5 × 105 THP-1 cells were resuspended in 20µL nucleofection solution (16.4µL SG nucleofector solution + 3.6µL supplement 1) from the SG Cell Line 4D-Nucleofector™ X kit (Lonza, V4XC-3032). 300pmol PPP2R1A sgRNA (Synthego ...
-
bioRxiv - Immunology 2021Quote: ... MICB or ULBP-1 genes after optimizing nucleofection conditions using primary cell 4D nucleofector kit and 4D nucleofector system (Lonza). After 48 hours of culture ...
-
bioRxiv - Microbiology 2022Quote: ... Ribonucleoproteins were introduced into 1 × 106 sub-confluent BlaER1 cells using 4D-Nucleofector X Unit and SF Cell line Kit (Lonza), applying program DN-100 ...
-
bioRxiv - Immunology 2022Quote: ... 1*106 purified naïve T-cells were resuspended in 15 μL buffer P3 + 5 μL Supplement 1 (P3 Primary Cell 4D-NucleofectorTM X Kit S; Lonza) and mixed with 2.7 μL RNP in the 16-well strips provided in the kit ...
-
bioRxiv - Immunology 2021Quote: ... 1 × 106 NALM6 target cells were transfected with 1 μg plasmid using the Nucleofector 4D (SF cell line Kit, program CV-104, Lonza) following the manufacturer’s instruction ...
-
bioRxiv - Developmental Biology 2022Quote: ... the cells were nucleofected with 1 nmol ASO against MERVL or Scramble ASO using P3 Primary Cell 96-well Nucleofector Kit (Lonza) according to manufacturer’s instruction and seeded into each well of a 24-well plate containing 500 µl of ESC medium with 2i ...
-
bioRxiv - Cell Biology 2022Quote: ... and a gene-edited iPSC homozygous MYBPC3 knock-out (MYBPC3 (-/-)) (Supplemental Table 1).(15–17) iPSCs were verified to be free of mycoplasma contamination using MycoAlert Detection Kit (Lonza). Newly generated lines were karyotyped (WiCell Institute ...
-
bioRxiv - Synthetic Biology 2022Quote: ... T cells were resuspended in P3 buffer (0.75-1 x 106 cells per 18 μl P3) from the P3 Primary Cell 4D-Nucleofector X Kit S (Lonza). 10 μg/μl Alt-R S.p ...
-
bioRxiv - Cell Biology 2022Quote: ... Two million of MNCs were transfected with 10 μg of plasmid (5:1 ratio pEB-C5:pEBTg) as instructed by the Lonza CD34+ nucleofector kit (VPA-1003, Lonza) and Amaxa nucleofector (program T-016 ...
-
bioRxiv - Microbiology 2023Quote: ... Knock-down procedures were performed with siRNA purchased from Riboxx (non-targeting siRNA: UUGUACUACACAAAAGUACCCCC; US10 targeting #1: UUCUGAAUAACACAGCCGCCCCC) applying the SE Cell Line Kit (Lonza) for fibroblasts and Lipofectamine RNAiMax (Invitrogen ...
-
bioRxiv - Microbiology 2023Quote: ... Ribonucleoproteins were introduced into 1 x 106 sub-confluent BLaER1 cells using 4D-Nucleofector X Unit and SF Cell line Kit (Lonza), applying program DN-100 ...
-
bioRxiv - Biophysics 2023Quote: ... MCF7 and A375 cells (ATCC) were transfected with 1 μg DNA using the SF Cell Line 4D-Nucleofector kit (Lonza) following the manufacturer’s instructions via electroporation (4D-Nucleofector ...
-
bioRxiv - Molecular Biology 2024Quote: ... 2 × 106 OSCs were transfected with 4 μg of pPB-TRE3G-FLAG-Rhino-Tjen-trTA-P2A-BlastR and 1 μg of pHsp70-Myc-hyPBase using Nucleofector Kit V (Lonza). After incubation in media containing blasticidin (50 μg/mL) ...
-
bioRxiv - Cell Biology 2024Quote: ... together with a plasmid encoding the piggyBac transposase in a 3:1 ratio (vector:transposase) using the P3 Primary cell 4D-Nucleofector™ kit (Lonza). Prior to targeting ...
-
bioRxiv - Microbiology 2020Quote: ... the medium was removed and replaced by Ultradoma Protein-Free (LONZA). The cultured medium was harvested and replenished on the second ...
-
bioRxiv - Genetics 2022Quote: ... membranes were stained with SYPRO-Ruby Protein Gel Stain (Lonza Rockland) to confirm equal loading ...
-
bioRxiv - Immunology 2023Quote: The 3 kbp DNA plasmid encoding green fluorescent protein (GFP) (Lonza) was used to assess transfection efficiency ...
-
bioRxiv - Molecular Biology 2021Quote: Telomerase human aortic endothelial cells (TeloHAECs) (ATCC, CRL-4052) were cultured in EBM-2 basal media (Lonza, 3156) supplemented with EGM-2 Bullet kit (Lonza ...
-
bioRxiv - Cell Biology 2022Quote: Human embryonic kidney 293 T-antigen (HEK293T) cells (ATCC) were cultured in Dulbecco’s modified Eagle’s medium (DMEM, Lonza) and supplemented with 10% fetal bovine serum (Thermo Fischer Scientific) ...
-
bioRxiv - Biochemistry 2021Quote: Plateable, cryopreserved primary human hepatocytes (pHep) from one male donor (18 years, BMI 28.7) were purchased from Lonza, Switzerland ...
-
bioRxiv - Microbiology 2020Quote: ... APRE-19 and Human embryonic kidney (HEK) 293T cells (ATCC) were maintained in Dulbecco’s Modified Eagle’s Medium (Lonza) supplemented with 10% fetal calf serum (Serana ...
-
bioRxiv - Molecular Biology 2021Quote: Human and mouse fibroblasts were cultured at 37°C and 5% CO2 in Dulbecco’s modified Eagle’s medium (Lonza) with high glucose supplemented with 10% foetal bovine serum ...
-
bioRxiv - Physiology 2022Quote: ... The cells used were human marrow derived mesenchymal stem cells (hMSCs, Lonza, Slough, UK, cat No PT- 2507). In the EPL001-terminus study they were seeded at 10,000 cells per well ...
-
bioRxiv - Synthetic Biology 2022Quote: ... T cells were cultured in human T cell medium (HTCM) consisting of X-VIVO 15 (Lonza #04-418Q), 5% Human AB serum ...
-
bioRxiv - Developmental Biology 2022Quote: Primary human umbilical vein endothelial cells (HUVECs, passage 2) were thawed and cultured in EGM-2 media (Lonza). Media was replaced every 48h ...