Labshake search
Citations for Lonza :
901 - 950 of 2083 citations for 7 AMINO 2 TERT BUTOXYCARBONYL 1 2 3 4 TETRAHYDROISOQUINOLINE 3 CARBOXYLIC ACID since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Developmental Biology 2023Quote: ... 5.0-8.0 × 105 BTAG cells were electroporated with 3 μg of each gRNA using Amaxa 4D nucleofector (Lonza, V4XP-3012) and the CA-137 program ...
-
bioRxiv - Developmental Biology 2023Quote: iPSCs were transfected with sgRNA 3’ UCCCUUUCCUCAGGUCACAG 5’ (Synthego) via nucleofection using program CA137 on a 4D Nucleofactor X (Lonza) as per manufacturer’s instructions ...
-
bioRxiv - Immunology 2024Quote: ... They were then transfected by nucleofection with 3 μg of plasmid DNA in 100 μl of Cell Line Nucleofector Solution V (Lonza) using the V-001 program (Amaxa Biosystems) ...
-
bioRxiv - Immunology 2024Quote: ... 3 x 106 freshly isolated monocytes or BMDMs were resuspended in 20 µl of P3 primary cell nucleofection buffer (Lonza). Cells were then added to the Cas9-RNP complexes ...
-
bioRxiv - Cancer Biology 2024Quote: ... were annealed to Cas9 protein (IDT) and the ribonucleoprotein complex was transfected into SKOV-3 cells using a 4D-Nucleofector (Lonza). Bulk transfected cells were checked by flow cytometry for successful knock-down ...
-
bioRxiv - Molecular Biology 2024Quote: ... The constructs were then transfected into WT OSCs and Δl(3)mbt-OSCs with Nucleofector Kit V (Lonza, VVCA-1003) using T-029 program and a NucleofectorTM 2b Device (Lonza) ...
-
bioRxiv - Microbiology 2024Quote: ... P.berghei schizonts were electroporated with 3 mg of each plasmid using the FI115 program on the Amaxa Nucleofector 4D (Lonza). Transfected parasites were promptly injected intravenously into BALB/c mice and were subjected to selection with 0.07 mg/mL of pyrimethamine in drinking water starting from day one post-infection ...
-
bioRxiv - Physiology 2024Quote: ... counted and 3.106 cells resuspended in 100 μl Nucleofactor R solution and electroporated with 3 µg of plasmid (pcDNA3 containing or not α7-5HT3 cDNA) using the Amaxa nucleofactor kit R (Lonza) according to the manufacturer instructions ...
-
bioRxiv - Neuroscience 2019Quote: COS-7 cells were maintained in DMEM (Lonza) supplemented with 10 % FBS (Sigma) ...
-
bioRxiv - Cell Biology 2020Quote: ... HPAEC cells were procured from Lonza (catalog # CC-2530) and cultured in Endothelial Basal Media-2 (Lonza catalog #: CC-3516) supplemented with endothelial growth factors optimized for aortic and pulmonary arterial endothelial cells (Lonza catalog # CC-3162) ...
-
bioRxiv - Molecular Biology 2021Quote: ... HEK293T cells (2 × 105) were resuspended with SF buffer (V4XC-2032, Lonza, Basel, Switzerland) and pulsed with purified SpyCas9 (20 pmol).
-
bioRxiv - Physiology 2019Quote: HPMVECs were cultured in Microvascular Endothelial Cell Growth Medium-2 (EGM™-2MV, Lonza). TGF-β2 (2.5 ng/mL) ...
-
bioRxiv - Immunology 2020Quote: ... and transduced with lentivirus to express CAR (MOI=2) in X-VIVO 15 (Lonza) containing 10% FCS with 5 μg/mL protamine sulfate (APP Pharmaceuticals) ...
-
bioRxiv - Genomics 2019Quote: Bone marrow aspirates (donor n = 2, female, ages 22 & 24) were purchased from LONZA and hMSCs were isolated by adherence to tissue culture flasks for 24 hours ...
-
bioRxiv - Cell Biology 2020Quote: ... were grown in EGM-2MV (Microvascular Endothelial Cell Growth Medium-2) medium from Lonza Bioscience ...
-
bioRxiv - Immunology 2021Quote: ... coated dishes (5 ng/cm2) and cultured in Endothelial Growth Medium 2 (EGM2, Lonza) supplemented with 50 ng/mL VEGF with medium changes every other day until they reached confluency ...
-
bioRxiv - Bioengineering 2021Quote: ... 2 mM L-glutamine and 50 units/ml penicillin/streptomycin (cDMEM; Lonza, Slough, UK). Soluble foam proteins were prepared as above ...
-
bioRxiv - Bioengineering 2021Quote: ... were maintained in 0.1% (w/v) gelatin-coated flasks with complete EGM-2 (Lonza) supplemented with 1% penicillin-streptomycin (Gibco) ...
-
bioRxiv - Bioengineering 2021Quote: ... Then cells were cultured in differentiation medium I consisting EBM-2 (Lonza, #CC-3156), 0.1% FBS ...
-
bioRxiv - Genetics 2021Quote: ... The cells were electroporated by using the Human Stem Cell Nucleofector Kit 2 (Lonza) and the Nucleofector 2b Device (Lonza) ...
-
bioRxiv - Cell Biology 2021Quote: ... Talin1&2 double null cells (Atherton et al. 2015) were cultured in DMEM:F12 (Lonza) supplemented with 10% FCS (Lonza) ...
-
bioRxiv - Cancer Biology 2022Quote: ... the culture medium was replaced with 2 mL of DMEM-F12 (LONZA #12-719F) supplemented with 10 % FBS ...
-
bioRxiv - Neuroscience 2020Quote: ... Control HUVEC and HUVEC Nucleolin KD were cultured in the EGM-2 medium (Lonza), at 37°C with 5% CO2 ...
-
bioRxiv - Microbiology 2020Quote: ... Hep-2 cells were cultured in Dulbecco’s Modified Eagle Medium (DMEM; Lonza or Gibco) supplemented with 10% FBS ...
-
bioRxiv - Bioengineering 2022Quote: ... were cultured in EBM-2 endothelial cell growth basal medium (Lonza, Bend, OR, USA) supplemented with EGM-2MV microvascular endothelial cell growth medium SingleQuots supplements (Lonza) ...
-
bioRxiv - Molecular Biology 2021Quote: ... PCR reactions were run on a 2% agarose gel (NuSieve™ GTG™, Lonza) and the 200-400 bp region was excised and purified using a QIAquick Gel Extraction Kit (#28704 ...
-
bioRxiv - Cell Biology 2019Quote: ... Talin1/2 double null cells (Atherton et al., 2015) were cultured in DMEM:F12 (Lonza) supplemented with 10% FCS (Lonza) ...
-
bioRxiv - Physiology 2019Quote: ... and cultured in EBM-2 medium supplemented with endothelial growth factors (EGM-2MV) (Lonza) for 14 days ...
-
bioRxiv - Immunology 2021Quote: ... hECs were grown in endothelial cell growth medium (EGM-2 Bulletkit; Lonza, Basel, Switzerland) supplemented with 10% fetal bovine serum (FBS) ...
-
bioRxiv - Cell Biology 2021Quote: ... The resulting hiMPs were expanded in myoblast growth and proliferation media (Lonza; SKBM-2). All myogenic cells were differentiated in DMEM containing 2% horse serum ...
-
bioRxiv - Bioengineering 2022Quote: Passage 2 primary human bone marrow derived MSC (PT-2501) were purchased from Lonza for all the experiments ...
-
bioRxiv - Biophysics 2022Quote: ... SAOS-2 cells were transfected using the SF buffer (Lonza, Cologne, Ger, V4XC-2012) and pulse code ‘DS-150’ ...
-
bioRxiv - Cell Biology 2024Quote: Human telomerase corneal epithelial (hTCEpi) cells 47 were cultured in KGM-2 media (Lonza) without antibiotics ...
-
bioRxiv - Microbiology 2022Quote: ... were obtained from Lonza (Cat# CC-2527) and cultured with EGM-2-MV medium (Lonza, Cat# CC-3202). For preparation of the airway-on-a-chip ...
-
bioRxiv - Molecular Biology 2023Quote: ... cells were washed with PBS and replaced with SkGM-2 BulletKit growth medium (Lonza) containing quercetin dissolved in DMSO at the indicated concentrations for 72 hours under standard culture conditions ...
-
bioRxiv - Microbiology 2022Quote: ... were obtained from Lonza (Cat# CC-2527) and cultured with EGM-2-MV medium (Lonza, Cat# CC-3202). For preparation of the airway-on-a-chip ...
-
bioRxiv - Immunology 2022Quote: ... We used the Human Stem Cell Nucleofector Kit 2 (Lonza, catalog no. LONVPH-5022). After electroporation ...
-
bioRxiv - Immunology 2023Quote: HUVECs were maintained in EBM-2 culture media according to the manufacturer’s instructions (Lonza). NF-κB signalling and cytokine release assays have been described previously [21] ...
-
bioRxiv - Biophysics 2023Quote: ... The cells were first cultured for initial proliferation in growth medium (SmGM- 2, Lonza). Then ...
-
bioRxiv - Bioengineering 2023Quote: Freestyle CHO-S cells were purchased from Thermo Scientific (Cat#R80007) and were expanded in PowerCHO 2 Serum-free Medium (Lonza BELN12-771Q) supplemented with GlutaMAX (Gibco) ...
-
bioRxiv - Neuroscience 2023Quote: ... 2 × 105 cells were resuspended in 17 μL of P3-supplemented nucleofection buffer (Lonza). We then added RNP mix ...
-
Changes in cell morphology and function induced by NRAS Q61R mutation in lymphatic endothelial cellsbioRxiv - Cell Biology 2023Quote: ... Cells were cultured in Endothelial Cell Growth Basal Medium-2 (EBM2) (Lonza, Basel, Switzerland) with 10% heat inactivated fetal bovine serum ...
-
bioRxiv - Microbiology 2023Quote: ... were obtained from Lonza (Cat# CC-2527) and cultured with EGM-2-MV medium (Lonza, Cat# CC-3202). For preparation of the airway-on-a-chip ...
-
bioRxiv - Immunology 2023Quote: ... Expanded Treg cells (2 × 106) were resuspended into P4 Primary Cell solution (Lonza Bioscience) and nucleofected with Cas9 protein and gRNAs ...
-
bioRxiv - Physiology 2023Quote: ... ciCMVEC were cultured in endothelial growth medium 2 microvascular (EGM2-MV; Lonza, Basel, Switzerland) containing 5% fetal calf serum but without vascular endothelial growth factor A or Gentamicin Sulfate-Amphotericin.
-
bioRxiv - Cell Biology 2023Quote: ... supplemented with 15% fetal bovine serum and 2 mM L-glutamine (Lonza, BE17-605E).
-
bioRxiv - Neuroscience 2023Quote: ... were cultured in an endothelial growth medium bullet kit (EGM- 2; Lonza, Basel, Switzerland) and used for experiments between passages three and seven ...
-
bioRxiv - Microbiology 2023Quote: ... were obtained from Lonza (Cat# CC-2527) and cultured with EGM-2-MV medium (Lonza, Cat# CC-3202). For preparation of the airway-on-a-chip ...
-
bioRxiv - Bioengineering 2023Quote: ... hECFCs were cultured according to manufacturer’s instructions in endothelial growth medium 2 (EGM2, Lonza) containing 10% fetal bovine serum (FBS ...
-
bioRxiv - Cancer Biology 2024Quote: ... and hFOB 1.19 (ATCC CRL-11372TM) were cultured in EBM-2 (Lonza #CC-3162) supplemented with EGM™ SingleQuots (Lonza #CC-4176) ...