Labshake search
Citations for Lonza :
851 - 900 of 1583 citations for L β Homo β 2 hydroxyphenyl glycine; R 3 Amino 3 2 hydroxyphenyl propanoic acid since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2024Quote: ... MSC and/or iEC were suspended in Endothelial Basal Medium 2 (EBM2, Lonza) at the desired density (MSC ...
-
bioRxiv - Bioengineering 2024Quote: ... HUVECs were cultured in EGM-2 Endothelial Cell Growth Medium (Lonza, CC-3162) and used between passages 2 and 6 ...
-
bioRxiv - Cell Biology 2024Quote: ... Cells were cultured in Endothelial Cell Growth Medium-2 BulletKit (CC-3162, Lonza) supplemented with 100 U/mL Penicillin (Thermo Fisher Scientific ...
-
bioRxiv - Cancer Biology 2024Quote: ... HUVEC cells were grown in EBM™-2 Basal Medium (Lonza, CC-3156) supplemented with 2% FBS ...
-
bioRxiv - Cell Biology 2024Quote: ... The HUVEC were cultured in endothelial cell growth basal medium (EGM-2; Lonza) supplemented with EGM-2 MV SingleQuot Kit Supplements and Growth Factors (Lonza ...
-
bioRxiv - Cell Biology 2024Quote: ... hRECs were cultured in EGM-2 BulletKit medium (Lonza, Basel, Switzerland, #CC-3162) supplemented with 2% fetal bovine serum ...
-
bioRxiv - Pathology 2023Quote: ... was maintained in growth media comprised of high glucose (4.5 g/L) and L-glutamine (0.6 g/L) Dulbecco’s Modified Eagle’s Media (DMEM) (#BE12-741F, Lonza), 10% foetal bovine serum (FBS ...
-
bioRxiv - Microbiology 2023Quote: ... and Nucleofector Kit R (Lonza) following manufacturer instructions ...
-
Strong paracrine effects of SASP from senescence-induced severe early-onset COPD-derived fibroblastsbioRxiv - Cell Biology 2023Quote: ... L-glutamine (Lonza), and 1% Penicillin/Streptomycin (Lonza ...
-
bioRxiv - Microbiology 2020Quote: ... Infected CD4 T cells were washed with PBS and 3 million cells per condition were resuspended in 20uL buffer P2 (Lonza) with 4μM IDT electroporation enhancer ...
-
bioRxiv - Immunology 2022Quote: ... Thawed PBMCS were rested for 3-4h at 37°C in X-VIVO 15 Serum-free Hematopoietic Cell Medium (Lonza) supplemented with 5% human Ab serum ...
-
bioRxiv - Genetics 2020Quote: ... ∼1×106 cells were transfected with pairs of 5 µg gRNA plasmid and 4 µg ssODN (Supplementary Table 3) using AmaxaTM Human CD34 Cell NucleofectorTM Kit (Lonza) in the 2B-NucleofectorTM on the U-08 setting ...
-
bioRxiv - Neuroscience 2020Quote: ... The spinal cord was spun at 3000 rpm for 3 min at room temperature after which the embryonic medium was replaced with 1x trypsin-EDTA (Lonza). The tissue was macerated in trypsin and incubated at 37°C for 15-20 mins ...
-
bioRxiv - Microbiology 2021Quote: ... Viral supernatants were collected 3 and 6 days post-infection and induced-cell death and viral titers were determined in the ToxiLight Bioassay (Lonza) and PFA ...
-
bioRxiv - Molecular Biology 2020Quote: ... at Day 3-4 of phase I culture were electroporated using P3 Primary Cell 4D NucleofectorTM X Kit (from Lonza) with program DZ100 (Bak et al. ...
-
PSGL-1 inhibits HIV-1 infection by restricting actin dynamics and sequestering HIV envelope proteinsbioRxiv - Microbiology 2020Quote: ... 1×106 activated CD4+T cells were stimulated by IFN-γ for 24 h before being transfected with 3 siRNAs following Amaxa Nucleofector following the manufacturer’s protocols (Lonza). Two days post transfection ...
-
bioRxiv - Cell Biology 2022Quote: ... and diseased COPD human lung fibroblasts (DHLFs) from 3 donors (donor IDs: OF3353, OF3418 and OF3238) were purchased from Lonza and tested for their response to FGF2 and TGFβ stimulation.
-
bioRxiv - Cancer Biology 2022Quote: ... and then combined with 3 µL of RNP mixture and nucleofected using program DJ-110 (melanoma) or EH100 (TILs) on a 4D Nucleofector (Lonza). Melanoma cells were immediately recovered in full melanoma media in 12-well plates ...
-
bioRxiv - Immunology 2021Quote: ... 2.106 T cells were resuspended in 20 µl of nucleofection solution with 3 µl or 4 µl RNP and transferred to Nucleofection cuvette strips (4D-Nucleofector X kit S; Lonza). Murine T cells were electroporated using the DN110 program of 4D nucleofector (4D-Nucleofector Core Unit ...
-
bioRxiv - Cell Biology 2021Quote: ... were isolated from healthy donors (n=3) as described[4] and seeded on 6 cm dishes within BEGM media (Lonza) before transduction with lentivirus (empty vector (Origene ...
-
bioRxiv - Microbiology 2021Quote: ... The human lung epithelial cell line Calu-3 (ATCC HTB-55) was maintained in DMEM F-12 (Lonza, Basel, Switzerland) supplemented with 10% FBS ...
-
bioRxiv - Bioengineering 2023Quote: Ha deposition was detected staining constructs sections (n≥10 from n≥3 chambers considering two different hACs and two different MSCs donors) with OsteoImage (Lonza) as detailed above ...
-
bioRxiv - Developmental Biology 2023Quote: ... 5.0-8.0 × 105 BTAG cells were electroporated with 3 μg of each gRNA using Amaxa 4D nucleofector (Lonza, V4XP-3012) and the CA-137 program ...
-
bioRxiv - Developmental Biology 2023Quote: iPSCs were transfected with sgRNA 3’ UCCCUUUCCUCAGGUCACAG 5’ (Synthego) via nucleofection using program CA137 on a 4D Nucleofactor X (Lonza) as per manufacturer’s instructions ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... Measured tissues originated from six F508del homozygous patients (CF patient #1: CF-AB0609, female, 31 years-old; CF patient# 3: #28388-0000450918, Lonza, male ...
-
bioRxiv - Cell Biology 2024Quote: ... together with a plasmid encoding the piggyBac transposase in a 3:1 ratio (vector:transposase) using the P3 Primary cell 4D-Nucleofector™ kit (Lonza). Prior to targeting ...
-
bioRxiv - Cell Biology 2024Quote: ... Cells were passaged 1:10 every 3-4 days by trypsinisation and were regularly screened for mycoplasma contamination (Mycoalert, Lonza).
-
bioRxiv - Immunology 2024Quote: ... They were then transfected by nucleofection with 3 μg of plasmid DNA in 100 μl of Cell Line Nucleofector Solution V (Lonza) using the V-001 program (Amaxa Biosystems) ...
-
bioRxiv - Immunology 2024Quote: ... They were then transfected by nucleofection with 3 μg of plasmid DNA in 100 μl of Cell Line Nucleofector Solution V (Lonza) using the V-001 program (Amaxa Biosystems) ...
-
bioRxiv - Immunology 2024Quote: ... 3 x 106 freshly isolated monocytes or BMDMs were resuspended in 20 µl of P3 primary cell nucleofection buffer (Lonza). Cells were then added to the Cas9-RNP complexes ...
-
bioRxiv - Cancer Biology 2024Quote: ... were annealed to Cas9 protein (IDT) and the ribonucleoprotein complex was transfected into SKOV-3 cells using a 4D-Nucleofector (Lonza). Bulk transfected cells were checked by flow cytometry for successful knock-down ...
-
bioRxiv - Molecular Biology 2024Quote: ... The constructs were then transfected into WT OSCs and Δl(3)mbt-OSCs with Nucleofector Kit V (Lonza, VVCA-1003) using T-029 program and a NucleofectorTM 2b Device (Lonza) ...
-
bioRxiv - Microbiology 2024Quote: ... P.berghei schizonts were electroporated with 3 mg of each plasmid using the FI115 program on the Amaxa Nucleofector 4D (Lonza). Transfected parasites were promptly injected intravenously into BALB/c mice and were subjected to selection with 0.07 mg/mL of pyrimethamine in drinking water starting from day one post-infection ...
-
bioRxiv - Molecular Biology 2024Quote: ... The cells were first electroporated with a PiggyBac-configured plasmid containing the Dox-inducible NbALFA-ABEL degrader cassette and a plasmid encoding the PiggyBac transposase at a 3:1 mass ratio via nucleofection (solution E with program CM138) according to manufacturer’s instructions (Lonza Inc.), followed by puromycin selection (5μg/ml ...
-
bioRxiv - Synthetic Biology 2024Quote: ... The optimised sequences were used to design gBlocks with appropriate overhangs (Fig. 1-3) and cloned into pMAX-GFP plasmid from Lonza, digested with KpnI and SacI (Fig ...
-
bioRxiv - Bioengineering 2024Quote: SP8 or DP T cells were isolated as described above and stimulated in vitro using irradiated K562 CD19-CD137L aAPCs at a 1:3 aAPC:T cell ratio in X-VIVO™ 15 (Lonza), supplemented with 5% human AB serum (Cat ...
-
bioRxiv - Cell Biology 2024Quote: ... 0.3×106 live cells were resuspended with the RNP complex and 20 µL of P3 Primary Cell Nucleofector Solution (Lonza), following the manufacturer’s instructions ...
-
bioRxiv - Pathology 2023Quote: Differentiated C2C12 myotubes were incubated in serum-free glucose (4.5 g/L) and L-glutamine (0.6 g/L) DMEM (#BE12-741F, Lonza) with 1% Penicillin-Streptomycin (10,000 U/ml ...
-
bioRxiv - Pathology 2023Quote: ... C2C12 myoblasts were differentiated into myotubes in a differentiation media comprised of high glucose (4.5 g/L) and L-glutamine (0.6 g/L) DMEM (#BE12-741F, Lonza), 2% horse serum (HS ...
-
bioRxiv - Cell Biology 2020Quote: ... HPAEC cells were procured from Lonza (catalog # CC-2530) and cultured in Endothelial Basal Media-2 (Lonza catalog #: CC-3516) supplemented with endothelial growth factors optimized for aortic and pulmonary arterial endothelial cells (Lonza catalog # CC-3162) ...
-
bioRxiv - Molecular Biology 2021Quote: ... HEK293T cells (2 × 105) were resuspended with SF buffer (V4XC-2032, Lonza, Basel, Switzerland) and pulsed with purified SpyCas9 (20 pmol).
-
bioRxiv - Immunology 2020Quote: ... and transduced with lentivirus to express CAR (MOI=2) in X-VIVO 15 (Lonza) containing 10% FCS with 5 μg/mL protamine sulfate (APP Pharmaceuticals) ...
-
bioRxiv - Cell Biology 2020Quote: ... were grown in EGM-2MV (Microvascular Endothelial Cell Growth Medium-2) medium from Lonza Bioscience ...
-
bioRxiv - Immunology 2021Quote: ... coated dishes (5 ng/cm2) and cultured in Endothelial Growth Medium 2 (EGM2, Lonza) supplemented with 50 ng/mL VEGF with medium changes every other day until they reached confluency ...
-
bioRxiv - Bioengineering 2021Quote: ... were maintained in 0.1% (w/v) gelatin-coated flasks with complete EGM-2 (Lonza) supplemented with 1% penicillin-streptomycin (Gibco) ...
-
bioRxiv - Bioengineering 2020Quote: ... Fluidic lines were coated with 1% gelatin which was replaced by EGM-2 (Lonza) for up to 24 hours ...
-
bioRxiv - Bioengineering 2021Quote: ... Then cells were cultured in differentiation medium I consisting EBM-2 (Lonza, #CC-3156), 0.1% FBS ...
-
bioRxiv - Genetics 2021Quote: ... The cells were electroporated by using the Human Stem Cell Nucleofector Kit 2 (Lonza) and the Nucleofector 2b Device (Lonza) ...
-
bioRxiv - Cell Biology 2021Quote: ... Talin1&2 double null cells (Atherton et al. 2015) were cultured in DMEM:F12 (Lonza) supplemented with 10% FCS (Lonza) ...
-
bioRxiv - Cancer Biology 2022Quote: ... the culture medium was replaced with 2 mL of DMEM-F12 (LONZA #12-719F) supplemented with 10 % FBS ...