Labshake search
Citations for Lonza :
851 - 900 of 3057 citations for Human Xylosyltransferase 1 XYLT1 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2023Quote: ... Knock-down procedures were performed with siRNA purchased from Riboxx (non-targeting siRNA: UUGUACUACACAAAAGUACCCCC; US10 targeting #1: UUCUGAAUAACACAGCCGCCCCC) applying the SE Cell Line Kit (Lonza) for fibroblasts and Lipofectamine RNAiMax (Invitrogen ...
-
bioRxiv - Microbiology 2023Quote: ... Ribonucleoproteins were introduced into 1 x 106 sub-confluent BLaER1 cells using 4D-Nucleofector X Unit and SF Cell line Kit (Lonza), applying program DN-100 ...
-
bioRxiv - Biophysics 2023Quote: ... MCF7 and A375 cells (ATCC) were transfected with 1 μg DNA using the SF Cell Line 4D-Nucleofector kit (Lonza) following the manufacturer’s instructions via electroporation (4D-Nucleofector ...
-
bioRxiv - Molecular Biology 2024Quote: ... 2 × 106 OSCs were transfected with 4 μg of pPB-TRE3G-FLAG-Rhino-Tjen-trTA-P2A-BlastR and 1 μg of pHsp70-Myc-hyPBase using Nucleofector Kit V (Lonza). After incubation in media containing blasticidin (50 μg/mL) ...
-
bioRxiv - Cell Biology 2024Quote: ... together with a plasmid encoding the piggyBac transposase in a 3:1 ratio (vector:transposase) using the P3 Primary cell 4D-Nucleofector™ kit (Lonza). Prior to targeting ...
-
bioRxiv - Molecular Biology 2021Quote: Telomerase human aortic endothelial cells (TeloHAECs) (ATCC, CRL-4052) were cultured in EBM-2 basal media (Lonza, 3156) supplemented with EGM-2 Bullet kit (Lonza ...
-
bioRxiv - Cell Biology 2022Quote: Human embryonic kidney 293 T-antigen (HEK293T) cells (ATCC) were cultured in Dulbecco’s modified Eagle’s medium (DMEM, Lonza) and supplemented with 10% fetal bovine serum (Thermo Fischer Scientific) ...
-
bioRxiv - Biochemistry 2021Quote: Plateable, cryopreserved primary human hepatocytes (pHep) from one male donor (18 years, BMI 28.7) were purchased from Lonza, Switzerland ...
-
bioRxiv - Microbiology 2020Quote: ... APRE-19 and Human embryonic kidney (HEK) 293T cells (ATCC) were maintained in Dulbecco’s Modified Eagle’s Medium (Lonza) supplemented with 10% fetal calf serum (Serana ...
-
bioRxiv - Molecular Biology 2021Quote: Human and mouse fibroblasts were cultured at 37°C and 5% CO2 in Dulbecco’s modified Eagle’s medium (Lonza) with high glucose supplemented with 10% foetal bovine serum ...
-
bioRxiv - Physiology 2022Quote: ... The cells used were human marrow derived mesenchymal stem cells (hMSCs, Lonza, Slough, UK, cat No PT- 2507). In the EPL001-terminus study they were seeded at 10,000 cells per well ...
-
bioRxiv - Synthetic Biology 2022Quote: ... T cells were cultured in human T cell medium (HTCM) consisting of X-VIVO 15 (Lonza #04-418Q), 5% Human AB serum ...
-
bioRxiv - Developmental Biology 2022Quote: Primary human umbilical vein endothelial cells (HUVECs, passage 2) were thawed and cultured in EGM-2 media (Lonza). Media was replaced every 48h ...
-
bioRxiv - Cell Biology 2022Quote: Human MSC were cultured in MSCBM™ Mesenchymal Stem Cell Basal Medium (MSCBM hMSC Basal Medium) (Lonza, UK) with necessary supplements (MSCGM hMSC SingleQuot Kit ...
-
bioRxiv - Neuroscience 2022Quote: ... Human umbilical vein endothelial cells (HUVECs) were cultured in EBM-2 medium supplemented with EGM-2 SingleQuots (Lonza) on plates coated with rat tail collagen I (20 µg/cm2 ...
-
bioRxiv - Cell Biology 2022Quote: ... EGM-2 was then added to each well along with 200µl of normal human lung fibroblasts (CC2512, Lonza) at a concentration of 2×105 cells/ml ...
-
bioRxiv - Cancer Biology 2019Quote: ... Human breast epithelial cell line MCF10a (ATCC CRL- 10317) was cultured in complete MEGM media (Lonza, Walkersville, MD) with 100 ng/ml cholera toxin at 37°C in 5% CO2 ...
-
bioRxiv - Bioengineering 2020Quote: Human bone marrow-derived mesenchymal stromal cells (MSCs) from a single donor were purchased from Lonza (Walkersville, MD). The trilineage potential of the cells was confirmed through induction in lineage-specific media ...
-
bioRxiv - Microbiology 2021Quote: ... The human lung epithelial cell line Calu-3 (ATCC HTB-55) was maintained in DMEM F-12 (Lonza) supplemented with 10% FBS ...
-
PSGL-1 inhibits HIV-1 infection by restricting actin dynamics and sequestering HIV envelope proteinsbioRxiv - Microbiology 2020Quote: ... the siRNAs were transfected into human CD4+ T cells using the Amaxa Nucleofector following the manufacturer’s protocols (Lonza). The siRNAs used in this study were purchased from GenePharma and the sequences are as below:
-
bioRxiv - Systems Biology 2022Quote: Human Dermal blood microvascular endothelial cells (DMECs) isolated from a single donor were purchased from Lonza (CC-2183). DMECs were cultured in EGM2-MV (Lonza ...
-
bioRxiv - Molecular Biology 2023Quote: Human embryonic kidney 293 (HEK293) cells (ATCC; CRL-1573) were grown in high-glucose DMEM (Lonza; BE12-604F) supplemented with 10% foetal bovine serum (FBS ...
-
bioRxiv - Developmental Biology 2023Quote: Human skeletal muscle myoblasts (CC-2561) and subcutaneous preadipocyte cells (PT-5020) were purchased from Lonza (Lonza Walkersville). Subcutaneous preadipocyte cells were induced to differentiate into terminal white adipocytes according to the manufacturer’s protocol.
-
bioRxiv - Immunology 2023Quote: ... PBMCs were loaded in these wells in human T cell media (X-VIVO media, Lonza, Cat# 04-418Q) supplemented with 5% human AB serum ...
-
bioRxiv - Immunology 2023Quote: ... PBMCs were loaded in these wells in human T cell media (X-VIVO media, Lonza, Cat# 04-418Q) supplemented with 5% human AB serum ...
-
bioRxiv - Biophysics 2023Quote: Human aortic endothelial cells (ATCC, Manassas, VA) were cultured in EGM-2 culture media (Lonza Walkersville, Basel, Switzerland) on 0.1% gelatin-coated plastic dishes until ∼80% confluence ...
-
bioRxiv - Cell Biology 2023Quote: Human mammary epithelial cells (HMECs) were cultured at 37°C with 5% CO2 in MEBM basal medium (Lonza) supplemented with MEGM SingleQuots (Lonza ...
-
bioRxiv - Synthetic Biology 2024Quote: ... T cells were cultured in human T cell medium (hTCM) consisting of X-VIVO 15 (Lonza #04-418Q), 5% Human AB serum and 10 mM neutralized N-acetyl L-Cysteine (Sigma-Aldrich #A9165 ...
-
bioRxiv - Cell Biology 2020Quote: BMDMs (1 × 106 cells) were transfected with siRNA (250 pmol) and Amaxa Mouse Macrophage Nucleofector Kit (Lonza, catalog number VPA-1009) using a Lonza Nucleofector 2b device (Lonza ...
-
bioRxiv - Microbiology 2021Quote: ... The Ala324Thr and the Glu655Asp mutations were independently recreated by transfecting the respective sgRNA template and donor dsDNA using the Basic Parasite Nucleofector™ Kit 1 (Lonza) with the U-033 program following manufacturer recommendations ...
-
bioRxiv - Genomics 2021Quote: ... K562 cells were grown to a density of 1×106 cells and electroporated with 5μg of plasmid DNA (Amaxa® Cell Line Nucleofector® Kit V, Lonza). Cells from each cell line were cultured for an additional 48 hours until total RNA isolation (Maxwell RSC simplyRNA kit ...
-
bioRxiv - Microbiology 2022Quote: ... NuLi-1 cells routinely tested negative for mycoplasma infection using MycoAlert Mycoplasma Detection Kit (LT07-418, Lonza Group AG, Basel, Switzerland) according to the manufacturer’s instructions.
-
bioRxiv - Cell Biology 2023Quote: ... brucei 13-90 cells were electroporated with 10 µg of linearised plasmid DNA using the Amaxa Basic Parasite Nucleofector Kit 1 and Nucleofector II device (program X-001) (Lonza, Switzerland).
-
bioRxiv - Cell Biology 2024Quote: ... and a control siRNA (D-001810-01-20 ON-TARGET plus Nontargeting siRNA #1) were prepared for electroporation using the Lonza SF Cell Line 4D-Nucleofector™ X Kit (V4XC-2012; Lonza) according to the manufacturer’s instruction with minor alterations ...
-
bioRxiv - Cell Biology 2020Quote: 1 million Jurkat cells were electroporated with the 2.5 μg of sgRNA plasmid and GFP control plasmid at a 10:1 ratio using an Amaxa Cell Line Nucleofector Kit V and an Amaxa™ Nucleofector™ II (Lonza). HeLa ...
-
bioRxiv - Immunology 2021Quote: ... 1.5×106 cells multiplied by the number of mice to be injected were transfected with the pIL-10 vector (1×106 cells/1.5 μg pIL-10 DNA per cuvette) using the Mouse T Cell Nucleofector Kit (Lonza, No: VPA-1006) with Nucleofector II Device (program X-100) ...
-
BRD2 inhibition blocks SARS-CoV-2 infection by reducing transcription of the host cell receptor ACE2bioRxiv - Cell Biology 2021Quote: ... complex with a ratio of 4.5 to 1 between sgRNA and Cas9 was delivered following the protocol of the SE Cell Line 4D-NucleofectorTM X Kit (Lonza, V4XC-1012), using the nucleofection program DS-130 on the Lonza 4D X unit ...
-
bioRxiv - Cell Biology 2021Quote: ... 500μg of gRNA and 500μg of donor plasmids were electroporated in 1×106 mESC using P3 Primary Cell 96-well Nucleofector™ Kit (Lonza, PBP3-22500) according to manufacturer’s instruction ...
-
bioRxiv - Biophysics 2022Quote: ... 106 U2OS cells were transfected with 1 μg of px330 plasmid and 1 μg of the HDR donor plasmid using the Nucleofector 2b device and cell line nucleofector kit V (Lonza, VCA-1003) per manufacturer’s protocol ...
-
bioRxiv - Genomics 2023Quote: ... 200,000 cells were nucleofected with 50 fmol transposon and 50 fmol transposase (Super piggyBac Transposase - SystemBio PB210PA-1) or with 300 ng pmaxGFP using the P2 Primary Cell 4D Nucleofector kit (Lonza V4SP-2096) and the Lonza 4D- Nucleofector with the DS-150 program ...
-
bioRxiv - Immunology 2022Quote: NIH3T3 WT fibroblast cells (3T3) and human CD40L-expressing 3T3 (Urashima et al., 1996) were cultured in IMDM (Lonza) containing 10% FCS (Bodinco) ...
-
bioRxiv - Genetics 2019Quote: ... Human multipotent adipose-derived stem cells (hMADS) were cultured in growth medium which consisted of: DMEM (Lonza, BE12-707F), 10% FBS ...
-
bioRxiv - Immunology 2019Quote: ... washed once in PBS and resuspended in Mouse B cell Nucleofector Solution with Supplement (murine B cells) or Primary Cell Nucleofector Solution 3 with Supplement (human B cells) prepared to the manufacturer’s instructions (Lonza) at a concentration of 4 - 5 × 106 cells / 86 μL ...
-
bioRxiv - Microbiology 2020Quote: A549 cells (human lung carcinoma cell line, ATCC CCL-185) were grown in Dulbecco’s modified eagle medium (DMEM) (Lonza) supplemented with 10% heat-inactivated fetal bovine serum (FBS ...
-
bioRxiv - Cell Biology 2020Quote: ... Eriksson’s lab) and human osteosarcoma (U2OS) (ATCC HTB-96) cells were cultured in high-glucose DMEM (Lonza, BE12-119F), supplemented with 10% FBS (Gibco ...
-
bioRxiv - Genetics 2019Quote: PBT cells were transfected with 5 μg DNA for 5.106 cells in 100 μl of Human T Cell Nucleofector Solution (Lonza) with the program U-014 (Amaxa Biosystems).
-
bioRxiv - Microbiology 2021Quote: Human airway tracheobronchial epithelial cells isolated from airway specimens from donors without underlying lung disease were provided by Lonza, Inc ...
-
bioRxiv - Microbiology 2021Quote: Human airway tracheobronchial epithelial cells isolated from airway specimens from donors without underlying lung disease were provided by Lonza, Inc ...
-
bioRxiv - Cell Biology 2022Quote: Human umbilical vein endothelial cells (HUVEC) were cultured between passage 3 and 6 in EGM-2 complete medium (Lonza)3,52–55 ...
-
bioRxiv - Neuroscience 2022Quote: Primary human astrocytes were cultured on Matrigel-coated (0.08 mg/well) 6-well plates in astrocyte growth medium (Lonza). On the day of plating ...