Labshake search
Citations for Lonza :
851 - 900 of 2203 citations for 5 Pyrimidinecarbonitrile 1 2 3 4 tetrahydro 4 oxo 6 phenyl 2 thioxo since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
Changes in cell morphology and function induced by NRAS Q61R mutation in lymphatic endothelial cellsbioRxiv - Cell Biology 2023Quote: ... Cells were cultured in Endothelial Cell Growth Basal Medium-2 (EBM2) (Lonza, Basel, Switzerland) with 10% heat inactivated fetal bovine serum ...
-
bioRxiv - Cell Biology 2024Quote: Human telomerase corneal epithelial (hTCEpi) cells 47 were cultured in KGM-2 media (Lonza) without antibiotics ...
-
bioRxiv - Bioengineering 2023Quote: ... hECFCs were cultured according to manufacturer’s instructions in endothelial growth medium 2 (EGM2, Lonza) containing 10% fetal bovine serum (FBS ...
-
bioRxiv - Cancer Biology 2021Quote: ... Primary uveal melanoma cells were equally divided onto two wells of a fibronectin-covered 6-well tissue culture plate and grown in 5% CO2 in MDMF medium which consists of HAM’s F12 (Lonza, Walkersville MD, USA) supplemented with 1 mg/mL BSA (Sigma-Aldrich ...
-
bioRxiv - Cancer Biology 2019Quote: ... 5 × 106 cells were co-transfected with 5 μg of pSpCas9(BB)– 2A–Puro:sgRNA #4 plasmid and 5 μg of pCSII–CMV:A3B–3×FLAG–IRES–EGFP donor DNA plasmid using the Amaxa Nucleofector (Lonza) with nucleofection solution R ...
-
bioRxiv - Cell Biology 2021Quote: ... siRNA directed against Dsg1 (Integrated DNA Technologies) with a targeting sequence 5′-CCATTAGAGAGTGGCAATAGGATGA-3′ using Amaxa Nucleofector System (Lonza) for electroporation of cells according to manufacturer’s instructions.
-
bioRxiv - Cell Biology 2021Quote: ... at a concentration of 10,000 units/l (penicillin) and 1 mg/l (streptomycin) and 2 mM L-glutamine (BioWhitaker, Lonza, 200 mM, cat. No. 17-605E), respectively ...
-
bioRxiv - Neuroscience 2021Quote: ... DRGs were then mechanically triturated and washed in a complete neurobasal A medium (NBA, Gibco® Invitrogen™ supplemented with 2% B27, 2mM L-glutamine and 1% antibiotics: penicillin + streptomycin, Lonza™ BioWhittaker™), before being plated in 35- mm petri dishes ...
-
bioRxiv - Microbiology 2024Quote: ... Erythrocyte cultures were established in 6 well plates using HL-1 medium (Lonza, Basel, Switzerland) supplemented with 20% human serum type A+ (Interstate Blood Bank) ...
-
Fascin regulates protrusions and delamination to mediate invasive, collective cell migration in vivobioRxiv - Cell Biology 2019Quote: Whole-mount Drosophila ovary samples were dissected into Grace’s insect media and fixed for 10 minutes at room temperature in 4% paraformaldehyde in Grace’s insect media (Lonza, Walkersville ...
-
bioRxiv - Immunology 2022Quote: ... The solution was centrifuged at 400G for 5 minutes at 4°C and the cell pellet was resuspended in 1mL of Hank’s Balanced Salt Solution (HBSS; Lonza) containing 1% BSA (Sigma Aldrich ...
-
Epigenetic Interaction between UTX and DNMT1 Regulates Diet-Induced Myogenic Remodeling in Brown FatbioRxiv - Physiology 2020Quote: SiRNAs or overexpressing plasmids were transfected into day 4 differentiated BAT1 brown adipocytes using Amaxa Nucleofector II Electroporator (Lonza) with an Amaxa cell line nucleofector kit L according to the manufacturer’s instructions (Lonza ...
-
bioRxiv - Immunology 2020Quote: ... Aliquots of 4 · 105 cells were transferred into individual wells of 16-well or 96-well nucleofection cuvettes (Lonza), combined with 20 µL pre-formed RNP or nucleofector solution (no RNP control) ...
-
bioRxiv - Immunology 2023Quote: ... 1e6 cells were then mixed with either Cas9 or base editor mRNA (4 - 4.5 µg) and nucleofected with program EO-115 using a 4D Nucleofector (Lonza). Immediately after nucleofection ...
-
bioRxiv - Developmental Biology 2021Quote: ... The resulting mixture was electrophoresed in NuSieve 3:1 agarose (Lonza 50091), and fragments sized 150-350 bp were excised and then purified using a MinElute Gel Extraction kit (QIAGEN 28604) ...
-
bioRxiv - Cancer Biology 2021Quote: ... batch 0000440546 and 0000442486) and cultured in EBMTM-2 Basal Medium (Lonza, Walkersville, MD, USA) with EGM-2MV Single Quots (Lonza ...
-
bioRxiv - Developmental Biology 2022Quote: ... myogenic progenitors were resuspended in skeletal muscle growth medium (SKGM-2, Lonza, Cat. CC-3245) with 10 µM ROCK inhibitor ...
-
bioRxiv - Neuroscience 2019Quote: ... Cells were nucleofected using the Human Stem Cell Nucleofector® Kit 2 (Lonza, VPH-5022) in combination with the AMAXA-2b nucleofector ...
-
bioRxiv - Genetics 2020Quote: ... 250 ng of plasmid per 2 × 105 cells was transfected using Amaxa solution SF (Lonza) and program CA-138 ...
-
bioRxiv - Cancer Biology 2021Quote: ... 2×106 fibroblasts were harvested and used in each transfection with a Nucleofector device (Lonza) according to the manufacturer’s protocol using the program T-20 and the Amaxa kit R (Lonza) ...
-
bioRxiv - Cell Biology 2021Quote: ... 2 mM L-Glu (Lonza, #17-602E, 100 U/ml Pen/Strep (Lonza, #17-602E), 10 mM HEPES (Sigma ...
-
bioRxiv - Cancer Biology 2020Quote: ... Human umbilical vein endothelial cells (HUVECs) prescreened for angiogenesis were cultured in EGM-2 (Lonza). Breast cancer cells were cultured in MammoCult (Stemcell Technologies ...
-
bioRxiv - Cell Biology 2021Quote: HeLa cells (ATCC CCL-2) were grown in DMEM with glucose and L-glutamine (Lonza), supplemented with 10% fetal bovine serum (FBS ...
-
bioRxiv - Molecular Biology 2022Quote: ... K562 cells (2×105 cells/transfection) were transfected with an Amaxa 4D-nucleofector™ (Lonza) using the SF nucleofection kit (program FF-120 ...
-
bioRxiv - Bioengineering 2022Quote: ... Cells were cultured in endothelial cell growth medium (EGM-2 CC-3162, Lonza, Basel, Switzerland), supplemented with BulletKit (CC-4176 ...
-
bioRxiv - Cancer Biology 2021Quote: ... Human umbilical vein endothelial cells (HUVEC) cultured in endothelial growth medium (EGM-2, Lonza, UK) for fewer than 5 passages were used in all experiments ...
-
bioRxiv - Genomics 2020Quote: ... or 2×103 cells per well of a 96-well culture plate in DMEM (Lonza) supplemented with 10% (v/v ...
-
bioRxiv - Bioengineering 2020Quote: ... 2% (w/v) L-glutamine and 0.1% (w/v) Gentamicin-Amphotericin (#PT-3001; Lonza, Germany) with 5% CO2 in air at 37°C ...
-
bioRxiv - Microbiology 2019Quote: ... concentrated KSHV stock solutions were diluted in 600 µl EBM-2 medium without supplements (LONZA). Target cells were then incubated with virus for two hours followed by substitution with culture medium.
-
bioRxiv - Cell Biology 2020Quote: ... (304-05a) were cultured in endothelial basal medium (EBM)-2 (LONZA Clonetics™ CC-3156) with 5% fetal bovine serum (GIBCO) ...
-
bioRxiv - Cell Biology 2020Quote: ... HK-2 cells were nucleofected using Mirus nucleofection solution and T20 program of nucleofector (Lonza).
-
bioRxiv - Cell Biology 2020Quote: ... cells were fed every 2 days with cardiac fibroblast basal media (CFBM) (Lonza, CC-3131) supplemented with 75ng/mL bFGF ...
-
bioRxiv - Microbiology 2020Quote: Human intestinal epithelial Caco-2 cells were cultured in Dulbecco’s Modified Eagle Medium (DMEM, Lonza), supplemented with 0.5% penicillin-streptomycin (50 μg/mL-50 μg/mL ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... Initiation of differentiation was done with Preadipocyte Differentiation Media (PDM-2) (Lonza, Cat: #PT-8002). Maintenance of differentiation was done with DMEM supplemented with 1.9 ng/mL Insulin (Sigma-Aldrich ...
-
bioRxiv - Bioengineering 2023Quote: ... HUVECs were maintained in EBM-2 MV BulletKit medium (CC-3156 and CC-4147; Lonza). HUVECs in passages 3-5 were used for all experiments.
-
bioRxiv - Bioengineering 2022Quote: ... Adipocyte spheroids were formed by culturing spheroids in pre-adipocyte differentiation medium (PDM-2, Lonza) containing 1% insulin ...
-
bioRxiv - Bioengineering 2023Quote: ... Human umbilical vein endothelial cells (HUVECs) were expanded in Endothelial Cell Growth Medium-2 (Lonza), harvested for use between passage P4- P6 ...
-
bioRxiv - Cancer Biology 2023Quote: ... Primary BMECs derived from healthy bone marrow specimens were cultured in EBM-2 media (Lonza) supplemented with necessary cytokines (Lonza).
-
bioRxiv - Biochemistry 2024Quote: ... were maintained and cultured in smooth muscle basal media (SmGM-2 BulletKit; CC-3182; Lonza). The media was supplemented with hEGF ...
-
bioRxiv - Developmental Biology 2023Quote: iPSCs were transfected with sgRNA 3’ UCCCUUUCCUCAGGUCACAG 5’ (Synthego) via nucleofection using program CA137 on a 4D Nucleofactor X (Lonza) as per manufacturer’s instructions ...
-
bioRxiv - Developmental Biology 2020Quote: ... anti-sense RNA probe against Gdnf exons was transcribed and hybridized on thick sections derived from P4 kidneys embedded in 4% low melting agarose (NuSieve GTG, Lonza). BM purple was used for colorimetric reaction.
-
bioRxiv - Cancer Biology 2021Quote: ... 4 μg of linearized plasmid containing wild-type or Ku70 3A cDNA was transfected using Amaxa nucleofector solution V (Lonza) and program T-020 ...
-
bioRxiv - Cell Biology 2022Quote: ... Expression of eGFP-Centrin1 was achieved by electroporating 4.106 B lymphoma cells with 4 μg of plasmid using the Amaxa Cell Line Nucleofector Kit R (T-016 program, Lonza). Cells were cultured in CLICK medium for 5 to 16 h before imaging.
-
bioRxiv - Biochemistry 2022Quote: ... and 18-36 μl ribonucleoprotein complexes were added along with 4 μM Alt-R Cas9 electroporation enhancer (IDT) to a nucleofection chamber (Lonza). Cells were electroporated using the nucleofector program EN-138 and gently resuspended in DMEM ...
-
bioRxiv - Cell Biology 2021Quote: ... or mutant) plasmids (4µg) were introduced to 4×106 dissociated neurons using Amaxa rat nucleofector kit (Lonza Bioscience, VPG-1003). Amaxa-nucleofected neurons plated at 500,000 cells per 35mm poly-D-lysine-coated glass bottom dish (WillCo Wells ...
-
bioRxiv - Microbiology 2020Quote: ... 20 µL of cell suspension was then gently mixed with each crRNP and aliquoted into a 96-well electroporation cuvette for nucleofection with the 4-D Nucleofector X-Unit (Lonza) using pulse code EO-120 ...
-
bioRxiv - Cell Biology 2021Quote: ... was generated by the introduction of a plasmid carrying the EGFP gene under the control of the CAG promoter to EStTA5-4 cells using the Amaxa Mouse ES cells Nucleofector Kit (VPH-1001, Lonza).
-
bioRxiv - Microbiology 2021Quote: ... Tightly synchronized schizonts were transfected using the Amaxa 4-D electroporator and P3 Primary Cell 4D Nucleofector X Kit L (Lonza) according to the protocol described by Moon et al ...
-
bioRxiv - Immunology 2020Quote: ... Cells were mixed with 5 μl of the RNP mixture by gently pipetting and were transferred to pre-cooled (4 °C) 16 well Nucleocuvette Strips (Lonza). Primary human B cells were nucleofected using the EH100 program of Lonza’s protocol ...
-
bioRxiv - Cell Biology 2021Quote: ... Western blots were conducted by running equivalent amounts of protein on 4-20% Tris-Glycine SDS/polyacrylamide gradient gels (Lonza) after reduction with 2-mercaptoethanol and heating to 95°C for 5m ...