Labshake search
Citations for Lonza :
801 - 850 of 1329 citations for N Furan 2 ylmethyl 3 bromo 4 fluoro benzamide since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2024Quote: ... the generated constructs were immersed in Endothelial Growth Medium 2 (EGM2, Lonza) and cultured under submerged conditions in a controlled incubator environment for up to 5 days ...
-
bioRxiv - Cell Biology 2024Quote: ... supplemented with EGM-2 MV SingleQuot Kit Supplements and Growth Factors (Lonza); 7 ...
-
bioRxiv - Cell Biology 2024Quote: ... supplemented with EGM-2 MV SingleQuot Kit Supplements and Growth Factors (Lonza) at 37L°C with 5% CO2 ...
-
bioRxiv - Developmental Biology 2024Quote: ... were purchased from Lonza Bioscience and were cultured in Endothelial Growth Medium-2 (cc-3162, Lonza) at 37°C and 5% CO2 ...
-
bioRxiv - Cancer Biology 2022Quote: ... 4 μg guide RNA and 200 pmol ssODN using the Amaxa Nucleofector II (Lonza, Basel, Switzerland). Cells were recovered in growth medium for 24 hr and then sorted as single cells into 96-well plates by FACS ...
-
bioRxiv - Cancer Biology 2024Quote: ... following the CA-137 program recommended by the manufacturer for MOLT-4 cells (Lonza, V4XC-2032). Post-electroporation ...
-
bioRxiv - Cell Biology 2021Quote: ... siRNA directed against Dsg1 (Integrated DNA Technologies) with a targeting sequence 5′-CCATTAGAGAGTGGCAATAGGATGA-3′ using Amaxa Nucleofector System (Lonza) for electroporation of cells according to manufacturer’s instructions.
-
bioRxiv - Cancer Biology 2022Quote: ... 3 µL of the sgRNA (total 300 pmol) was added to 12 µL of SE buffer (Lonza V4XC-1032). In another well ...
-
bioRxiv - Biochemistry 2021Quote: ... For each nucleofection 3 x 106 cells were resuspended in 80 μl of mouse ES cell nucleofection solution (Lonza). Equimolar (0.32 nmol ...
-
bioRxiv - Cancer Biology 2020Quote: ... were used in passages 3-6 and cultured on 0.1% gelatin-coated tissue culture plates in complete EGM2 (Lonza) supplemented to a total of 10% Fetal Bovine Serum (FBS) ...
-
bioRxiv - Bioengineering 2024Quote: ... and SK-BR-3 cells (Korean Cell Line Bank, Korea) were cultured in Dulbecco’s modified Eagle’s medium (DMEM; Lonza, Switzerland) supplemented with 10 % (v/v ...
-
bioRxiv - Cell Biology 2022Quote: Normal human bronchial epithelial cells (HBECs) from 3 independent donors (Supplemental Table S1) were obtained from Lonza (CC-2540) and cultured in BEGM growth media (Lonza CC-3170) ...
-
bioRxiv - Biophysics 2023Quote: ... DNA samples were also analyzed by electrophoresis through 1.5 % and 3 % agarose gels (Seakem LE agarose, Lonza, Rockland, ME) in TAE (Tris-acetate + 1 mM EDTA ...
-
Self-organised pattern formation in the developing neural tube by a temporal relay of BMP signallingbioRxiv - Developmental Biology 2023Quote: A total of 3-4µg of plasmid DNA was electroporated into 3-4x106 early passage ES cells using the Amaxa Nucleofector II (Lonza) programme A-023 ...
-
bioRxiv - Neuroscience 2024Quote: ... and 300μM single stranded oligodeoxynucleotides (ssODN: 5’gggtccagggtggctgtcactcat ccttttttctggctaccaaaggtgcagataattaaGaagaagctggatcttagcaacgtccagccaagtgtggctcaaaggataatatc aaacacgtcc 3’) and the P3 Primary Cell 4D reaction mix (Lonza). We screened a minimum of 96 clones for genetic editing ...
-
bioRxiv - Genetics 2024Quote: ... Approximately 2.5×105 CD34+ HSPCs were mixed with gRNA:Cas9 complexes and 3 µg ssDNA donor template (20 μL) in nucleofector strip format (Lonza). Electroporation was performed in Unit X ...
-
bioRxiv - Cell Biology 2024Quote: ... NHEKs (no later than passage 3) were cultured in KGM Gold Keratinocyte Growth Medium BulletKit (00192060, Lonza, Basel, Switzerland). For daily maintenance and subculturing of NHEKs ...
-
bioRxiv - Cell Biology 2020Quote: ... supplemented with the Endothelial Growth Medium (EGM-2) bullet kit (CC-3162, Lonza) and 1x antibiotic-antimycotic (Gibco) ...
-
bioRxiv - Cell Biology 2021Quote: ... Cells were cultured in Endothelial Cell Growth Medium-2 BulletKit (CC-3162, Lonza) with 100 U/ml Penicillin (Thermo Fisher Scientific ...
-
bioRxiv - Bioengineering 2021Quote: ... Cells were supplemented with EGM−-2 endothelial cell growth medium (Lonza, Basel, Switzerland). Cells were passage at 70 – 80 % confluency ...
-
bioRxiv - Bioengineering 2020Quote: ... were cultured with the Endothelial Cell Growth Medium-2 BulletKit (Lonza CC-3162) All cultures were maintained at 37°C ...
-
bioRxiv - Bioengineering 2020Quote: ... These cells were cultured and maintained in EGM-2 Bulletkit (CC-3162, Lonza). KLF2-GFP reporter cells were cultured M199 medium (12117F ...
-
bioRxiv - Cell Biology 2021Quote: ... Undifferentiated myoblasts were maintained in Skeletal Muscle Growth Media-2 (CC-3245; Lonza). 7.5 × 104 myoblasts were seeded on 30-mm dishes for immunocytochemistry ...
-
bioRxiv - Bioengineering 2021Quote: ... were grown in Fibroblast Growth Medium (FGM-2 BulletKit™, CC-3132, Lonza). Cells were cultured under a humidified incubator at 37°C and 5% CO2 and grown up to 80% confluency for experiments ...
-
bioRxiv - Microbiology 2020Quote: ... pre-warmed DMEM with 2 % FBS mixed with liquid SeaPlaque™ Agarose (Lonza) to a final concentration of 0.8 % agarose was added to cells two hours post infection ...
-
bioRxiv - Immunology 2020Quote: ... PBMCs were expanded for 2 weeks in X-vivo media (Lonza, BE02-060Q) supplemented with 5% human serum (Gibco ...
-
bioRxiv - Cancer Biology 2020Quote: ... Sorted cells were cultured in Endothelial Growth Media (EGM-2) (Lonza, Basel, Switzerland) on 2% gelatin-coated chamber slides ...
-
bioRxiv - Cancer Biology 2020Quote: ... 2 mM L-Glutamine and 100 U/ml Pen-Strep (all from Lonza). Cell lines were regularly tested for mycoplasma contamination ...
-
bioRxiv - Bioengineering 2022Quote: ... were obtained from Lonza (CC-2576) and cultured using SmGM™-2 BulletKit™ (Lonza CC-3182). All cells were from patients ranging in age from 30 to 65 years old and were sub-cultured according to Lonza’s recommended protocol.
-
bioRxiv - Biochemistry 2022Quote: ... grown to 1.6-2 million cells/ml in Insect-XPRESS media (Lonza™), were infected with P1 viral stocks at 16 ml/L ...
-
bioRxiv - Cell Biology 2022Quote: ... supplemented with the Endothelial Growth Medium (EGM-2) bullet kit (CC-3162, Lonza) and 1x antibiotic-antimycotic (Gibco) ...
-
bioRxiv - Genomics 2020Quote: ... The first consisted of 2 μl/well pmaxGFP DNA (LONZA,1 μg/ul) diluted in 250 μl/well Opti-MEM® medium (ThermoFisher Scientific ...
-
bioRxiv - Microbiology 2021Quote: ... HSC-2 (JCRB0622) cells were cultured in EMEM (Eagle’s Minimum Essential Medium; Lonza), while HO-1-N-1 (JCRB0831 ...
-
bioRxiv - Immunology 2020Quote: RAW264.7 and 293 TLR4/CD14/MD-2 cells were cultured in DMEM (Lonza) supplemented with 10 % FBS (Gibco ...
-
bioRxiv - Cell Biology 2020Quote: ... Samples were collected after two days in SKGM (SKGM-2, Lonza CC-3245) culture ...
-
bioRxiv - Cell Biology 2020Quote: ... supplemented with Endothelial Cell Growth Medium (EGM)-2 Bullet Kit (CC-3162; Lonza)) ...
-
bioRxiv - Cell Biology 2021Quote: ... The hMBs were maintained in Skeletal Muscle Growth Media-2 (CC-3245; Lonza) as a growth medium for hMBs (hMB-GM) ...
-
bioRxiv - Cancer Biology 2021Quote: ... were obtained from Lonza and were cultured in EGM-2 SingleQuot Kit media (Lonza, cat #CC-3162) and used at passage 2-10 ...
-
bioRxiv - Microbiology 2021Quote: ... cells were overlaid with 1:1 mixture of 2% agarose (Lonza, Basel, Switzerland) and 2X MEM medium ...
-
bioRxiv - Bioengineering 2022Quote: ... that was supplemented with EGM™-2 SingleQuots™ supplements (LONZA, CC-4176), 10 % FCS and 1 % P/S ...
-
bioRxiv - Molecular Biology 2022Quote: ... HAECs were cultured in EBM-2 supplemented with singleQuots (LONZA, Clonetics CC-4176) and Endothelial Cell Growth Kit-VEGF (ATCC ...
-
bioRxiv - Microbiology 2022Quote: Human corneal epithelial cells (hTCEpi) (67) were cultured in KGM-2 (Lonza, USA) supplemented with 1.15 mM calcium chloride (high-calcium ...
-
bioRxiv - Molecular Biology 2022Quote: ... and the recommended growth supplements (FGM™-2 SingleQuots™, CC-4126, Lonza). Primary human skin fibroblasts (2320 ...
-
bioRxiv - Bioengineering 2022Quote: ... LECs were cultured in EGM™-2 endothelial growth medium (Lonza, Basel, Switzerland). Primary HSCs were collected after selecting Kupffer cells and LECs ...
-
bioRxiv - Cancer Biology 2023Quote: 2.5 x 105 HUVEC (< 6th passage) in 120 µL EGM-2 media (Lonza) were seeded in channel slides (µ-Slides 0.4 Luer ...
-
bioRxiv - Cell Biology 2023Quote: ... Cells were cultured in Endothelial Cell Growth Medium-2 BulletKit (CC-3162, Lonza) with 100 U/ml Penicillin (Thermo Fisher Scientific ...
-
bioRxiv - Physiology 2023Quote: ... Preadipocyte cells were maintained in preadipocyte growth media-2 (Lonza Cat #PT-8002). For experiments ...
-
bioRxiv - Physiology 2023Quote: ... Preadipocyte cells were maintained in preadipocyte growth media-2 (Lonza Cat #PT-8002).
-
bioRxiv - Bioengineering 2023Quote: ... cultured according to supplier’s directions in supplemented EBM-2 endothelial basal medium (Lonza); and normal human astrocytes (NHAs ...
-
bioRxiv - Biophysics 2023Quote: ... 95% humidity and 5% CO2 in Fibroblast Growth Medium (FGM-2, Lonza, Basel).