Labshake search
Citations for Lonza :
751 - 800 of 970 citations for TSLP R Human HEK 293 His since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2020Quote: ... Human ventricular cardiac fibroblasts that were harvested from normal adult ventricular tissue were obtained from Lonza, maintained at low passage number (<12) ...
-
bioRxiv - Neuroscience 2022Quote: ... Antibodies were validated with Western blot analysis using protein from Neuronal Human Astrocytes (Lonza, CC-2565) as previously reported in Knight and Serrano (2017a).
-
bioRxiv - Microbiology 2022Quote: ... Human bronchial epithelial cells (NuLi-1) were cultured as previously described (19) in BEGM (Lonza, USA) with 1.15 mM calcium chloride and maintained as for hTCEpi ...
-
bioRxiv - Cancer Biology 2022Quote: ... Normal human bronchial epithelial (NHBE) cells were purchased from Lonza (Cat. No. CC-2541, Basel, Switzerland), and were cultured in Lonza’s bronchial epithelial cell growth medium (Cat ...
-
bioRxiv - Bioengineering 2023Quote: Commercially available human adipose derived stem cells (ADSCs) (Catalog number: PT-5006, Lonza, Walkersville, MD, USA) were cultured in HyClone Dulbecco’s modified Eagle medium (F12 ...
-
bioRxiv - Immunology 2023Quote: Human Umbilical Vein Cells (HUVECs) were cultured in EBM Endothelial Cell Growth Basal Medium (Lonza, Swiss) supplemented with EGMTM Endothelial Cell Growth Medium SingleQuots (Lonza ...
-
bioRxiv - Immunology 2023Quote: Primary normal human bronchial epithelial cells (NHBECs) were sourced from Lonza (NHBE CC-2540; Walkersville, MD). These Lonza NHBECs were obtained from a 65-year-old Caucasian male without identifiers ...
-
bioRxiv - Bioengineering 2023Quote: Human mesenchymal stromal cells (MSCs) were isolated from single donor bone marrow (Lonza, Walkersville, MD, USA) based upon their adherence to tissue-culture treated flasks in standard conditions ...
-
bioRxiv - Biochemistry 2022Quote: ... Cryopreserved primary normal human bronchial epithelial (NHBE) cells were purchased from Lonza (CC-2540 & CC-2540S) and ATCC (PCS-300-010) ...
-
bioRxiv - Cancer Biology 2023Quote: Human peripheral blood mononuclear cells (PBMCs) and peripheral blood CD4-positive cells were purchased from Lonza (product numbers CC-2702 and 2W-200 ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... The human monocyte THP-1 cells were cultured in RPMI 1640 media from Lonza (NSW, Australia), containing 4.5 g/L D-glucose and supplemented with 2 mM GlutaMax ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: The experiments were performed using the Human Aortic Endothelial Cells (HAEC) purchased from Lonza (CC-2535). Cells were cultured in EBM™-2 Basal Medium (Lonza ...
-
bioRxiv - Bioengineering 2024Quote: The hMSCs were isolated from human bone marrow aspirate (Lonza; donor = 18-year-old black female) and serial expanded following previously described protocols[44] ...
-
bioRxiv - Immunology 2024Quote: ... Raji and Daudi (human CD20-positive Burkitt’s lymphoma) cells were cultured in RPMI 1640 medium (Lonza), supplemented with 10% (v/v ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... RNA complex and Alt-R HDR Donor Oligos were transfected into HCT116 cells by electroporation (Lonza Nucleofector 96-well Shuttle System; Lonza, Bend, OR) using parameters provided by the manufacturer ...
-
bioRxiv - Biochemistry 2024Quote: 1 µL of 63 µM Alt-R™ S.p.Cas9 V3 (IDT: 10007807) was diluted with 18 µL of SE Cell Line Nucleofector® Solution (Lonza V4XC-1032), followed by the addition of 1.8 µL of 100 µM sgRNA (3:1 sgRNA:Cas9) ...
-
bioRxiv - Synthetic Biology 2021Quote: ... This mixture was nucleofected with 2×106 stimulated human primary T cells using the 4D-Nucleofector (Lonza) with the program EO-115 ...
-
bioRxiv - Genetics 2021Quote: ... RNPs containing recombinant CRISPR/Cas9 and sgRNA were transfected to human cell lines using a Nucleofector (Lonza). Stable cell lines were generated by selection of hygrogmycin resistance ...
-
bioRxiv - Immunology 2021Quote: ... were expanded in 75 cm2 tissue culture flasks using human endothelial cell growth medium (Lonza, CC-3202) until 70-80% confluent.
-
bioRxiv - Microbiology 2019Quote: ... brucei using the Human T-cell nucleofection® kit and an Amaxa® Nucleofector™ (Lonza AG) set to program X-001 ...
-
bioRxiv - Developmental Biology 2019Quote: ... The human Atoh8 expression plasmid [30] was transfected by electropulsing using the Cell Line Nucleofector System (Lonza) following standard procedures provided by the manufacturers.
-
bioRxiv - Cell Biology 2019Quote: ... MCF10A (human breast epithelial cell line) were cultured in Mammary Epithelial Cell Growth Medium (Lonza, CC-3151) with supplements and growth factors (Lonza ...
-
bioRxiv - Synthetic Biology 2021Quote: ... T cells were cultured in human T cell medium consisting of X-VIVO 15 (Lonza #04-418Q), 5% Human AB serum and 10 mM neutralized N-acetyl L-Cysteine (Sigma-Aldrich #A9165 ...
-
bioRxiv - Bioengineering 2021Quote: Human bone marrow-derived MSCs were obtained from 4 different donors purchased from Lonza (Walkersville, MD, USA), AllCells (Emeryville ...
-
bioRxiv - Bioengineering 2021Quote: Human umbilical vein endothelial cells (ECs) were cultured in endothelial growth medium (EGM-2; Lonza, Basel, Switzerland) supplemented with 1% penicillin-streptomycin-fungizone (Gibco ...
-
bioRxiv - Synthetic Biology 2021Quote: ... T cells were cultured in human T cell medium consisting of X-VIVO 15 (Lonza #04-418Q), 5% Human AB serum and 10 mM neutralized N-acetyl L-Cysteine (Sigma-Aldrich #A9165 ...
-
bioRxiv - Biophysics 2020Quote: Human mesenchymal stem cells (PT-2501) used for proof-of-principle dSTORM imaging were purchased from Lonza Group ...
-
bioRxiv - Microbiology 2021Quote: ... whereas human monocyte cell line U937 (ATCC CRL-1593.2) was maintained in complete RPMI 1640 media (Lonza) with 100 µM β-mercaptoethanol and differentiated to macrophages using 20 ng/ml PMA for 24 hours prior to infection ...
-
bioRxiv - Biochemistry 2022Quote: Human Aortic Endothelial Cells (HAEC) derived from two the same age male donors were purchased from Lonza. Cells were grown in Endothelial Cell Growth Medium BulletKit®-2 (EGM-2 BulletKit ...
-
bioRxiv - Neuroscience 2020Quote: ... Me49-Luc tachyzoites were maintained in vitro in monolayers of Normal Human Dermal Fibroblasts-Neonatal (NHDF, Lonza; kindly provided by Dr ...
-
bioRxiv - Developmental Biology 2019Quote: Human umbilical vein endothelial cells (HUVECs) were maintained in supplemented EGM2 medium (EGM2 Bulletkit, K3CC-3162 Lonza). Cells were transduced on suspension at a multiplicity of infection (m.o.i. ...
-
bioRxiv - Cell Biology 2020Quote: ... using the Human CD34+ nucleofector kit and the Nucleofector II device (both from Lonza Group Ltd., CH) following manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2019Quote: Human umbilical endothelial vein cells (HUVEC) were serum-starved overnight in EGM-2 media (Lonza, CC-3162) containing 0.2% FBS ...
-
bioRxiv - Microbiology 2021Quote: Normal human bronchial epithelial (NHBE) cells (donor 41219) were purchased from Lonza (Walkersville, MD Cat# CC-2540) and maintained in Bronchial Epithelial Cell Growth Medium (BEGM ...
-
bioRxiv - Cancer Biology 2019Quote: ... Human umbilical vein endothelial cells (HUVEC) were grown in endothelial cells growth medium-2 (EGM-2) (Lonza). All cells were cultured at 37◻°C and 5% CO2 in incubator cells.
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... 100 μg/ml streptomycin and 15 ng/ml recombinant human macrophage colony stimulating factor (Lonza, Melbourne, Australia) on 10 mm square dishes (Bio-strategy ...
-
bioRxiv - Physiology 2021Quote: ... healthy human and diabetic patient coronary artery endothelial cells (Healthy and Diabetic hCEC) were purchased from Lonza. The cells were cultured in the medium supplied from the companies as instructed ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... Human umbilical venous endothelial cells (HUVECs) and EGM-2 bullet kits were obtained from Lonza (Basel, Switzerland).
-
bioRxiv - Cell Biology 2020Quote: ... Primary human pulmonary arterial smooth muscle cells (PASMCs) were cultured in SmGM-2 cell culture media (Lonza), and experiments were performed at passages 3 to 9 ...
-
bioRxiv - Biophysics 2023Quote: the first cell lineage (named ASMC_1 onwards) is a commercial immortalized human ASMCs lineage purchased from Lonza and delivered at passage 3 ...
-
bioRxiv - Microbiology 2023Quote: Caco-2 cells (human intestinal epithelial cell line) were cultured in DMEM - Dulbecco’s Modified Eagle Medium (Lonza) supplemented with 10% FBS (Gibco) ...
-
bioRxiv - Cancer Biology 2023Quote: Human breast adipose tissue was incubated in mammary epithelial cell growth base medium (MEBM) (Lonza #cc-3151) supplemented with 0.5% bovine serum albumin (BSA ...
-
bioRxiv - Synthetic Biology 2024Quote: ... T cells were cultured in human T cell medium consisting of X-VIVO 15 (Lonza #04-418Q), 5% Human AB serum and 10 mM neutralized N-acetyl L-Cysteine (Sigma-Aldrich #A9165 ...
-
bioRxiv - Molecular Biology 2021Quote: ... and Alt-R™ HDR donor oligo 5’ GTGTTTAGAAAAAAAAGAGTGTTTTTTTACCAGGGCCTTTGGCTCTTCCAGGAAGCAGATGTCCGAGTCGGAATATAATAACCCTTTCATACTCTTG 3’ (PS modification, antisense; IDT) using a 4D-nucleofector System X Unit (Lonza, Basel, Switzerland) and the P3 primary Cell 4D-Nucleofector® X kit (#V4XP-3024 ...
-
bioRxiv - Biochemistry 2019Quote: ... For CENP-C overexpression we transfected HeLa cells with pEGFP-CENP-C using the Amaxa Cell Line Nucleofector Kit R (Lonza cat#VVCA-1001) per manufacturer’s instructions ...
-
bioRxiv - Biophysics 2023Quote: ... we transfected HeLa cells with SNAP-tagged CENP-A (generous gift from Dan Foltz) in combination with either empty vector or GFP-CENP- C using the Amaxa Nucleofector kit R (Lonza Bioscience, Walkersville, MD) per instructions.
-
bioRxiv - Cancer Biology 2023Quote: ... Plasmids expressing ETS1 sgRNAs (see Supplemental Table S1) were co-electroporated into the dCas9-VP64-expressing cells using the AmaxaTM Cell Line Nucleofector™ Kit R (Lonza, VCA-1001) and further subjected to puromycin selection and single-cell cloning ...
-
bioRxiv - Molecular Biology 2021Quote: Telomerase human aortic endothelial cells (TeloHAECs) (ATCC, CRL-4052) were cultured in EBM-2 basal media (Lonza, 3156) supplemented with EGM-2 Bullet kit (Lonza ...
-
bioRxiv - Immunology 2021Quote: ... and the next day (day 1) sequentially seeding primary human lung microvascular endothelial cells (Lonza, CC-2527, P5) and primary human lung alveolar epithelial cells (Cell Biologics ...
-
bioRxiv - Biochemistry 2021Quote: Plateable, cryopreserved primary human hepatocytes (pHep) from one male donor (18 years, BMI 28.7) were purchased from Lonza, Switzerland ...