Labshake search
Citations for Lonza :
751 - 800 of 1886 citations for 6H Purin 6 one 1 2 3 9 tetrahydro 3 methyl 2 thioxo since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Bioengineering 2023Quote: ... cultured according to supplier’s directions in supplemented EBM-2 endothelial basal medium (Lonza); and normal human astrocytes (NHAs ...
-
bioRxiv - Physiology 2023Quote: ... Preadipocyte cells were maintained in preadipocyte growth media-2 (Lonza Cat #PT-8002). For experiments ...
-
bioRxiv - Physiology 2023Quote: ... Preadipocyte cells were maintained in preadipocyte growth media-2 (Lonza Cat #PT-8002).
-
bioRxiv - Cell Biology 2023Quote: ... Cells were cultured in Endothelial Cell Growth Medium-2 BulletKit (CC-3162, Lonza) with 100 U/ml Penicillin (Thermo Fisher Scientific ...
-
bioRxiv - Bioengineering 2022Quote: ... Pre-adipocyte spheroids were maintained in pre-adipocyte growth medium (PGM-2, Lonza) containing 10% fetal bovine serum (FBS) ...
-
bioRxiv - Cell Biology 2023Quote: ... HEK STIM1/2-/- were transfected via electroporation using the Amaxa Nucleofector II (Lonza) according to the manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2023Quote: ... on 0.2% gelatin-coated plates with EGM-2 bulletkit medium (Lonza, Basel, Switzerland), containing EBM-2 basal medium along with the EGM-2 singlequots kit components ...
-
bioRxiv - Physiology 2023Quote: ... Switzerland) and supplemented with Microvascular Endothelial Cell Growth Medium-2 Bullet Kit (Lonza).
-
bioRxiv - Neuroscience 2023Quote: ... The squares were incubated for 2 minutes with L7 hPSC passaging solution (Lonza). After aspirating the L7 solution ...
-
bioRxiv - Molecular Biology 2023Quote: ... HPAECs were cultured for 4 hours in endothelial basal medium (EBM-2, Lonza) with 2% FBS ...
-
bioRxiv - Cell Biology 2023Quote: ... 2 x 105 cells were resuspended in 20 µL Nuclofector Solution SF (Lonza), combined with the assembled Cas9 RNPs ...
-
bioRxiv - Cancer Biology 2023Quote: 2.5 x 105 HUVEC (< 6th passage) in 120 µL EGM-2 media (Lonza) were seeded in channel slides (µ-Slides 0.4 Luer ...
-
bioRxiv - Bioengineering 2023Quote: ... were cultured at 37°C and 5% CO2 with EBM-2 medium (Lonza) and EGM-2MV supplements in T-75 flasks until confluent ...
-
bioRxiv - Molecular Biology 2024Quote: ... 2-4 x 105 cells were resuspended in 100uL of P2 medium (Lonza) containing 10 µg of Cas9 or Cas9/guide plasmidic DNA and transferred to a cuvette (Lonza) ...
-
bioRxiv - Cell Biology 2020Quote: ... Conditioned media (containing EVs) was removed and the cells washed x 2 with PBS before trypsinisation using 1 × Trypsin-EDTA (Lonza, UK cat: T3924). Cell counts and viability were checked at the time of EV harvest using the trypan blue exclusion assay (0.4% Trypan blue solution ...
-
bioRxiv - Neuroscience 2020Quote: ... 20 pmol Cas9 nuclease (sgRNA to Cas9 nuclease ratio used as 9:1) was performed with Amaxa 2D Nucleofector (Lonza, program B016). After recovery ...
-
bioRxiv - Microbiology 2020Quote: ... Infected CD4 T cells were washed with PBS and 3 million cells per condition were resuspended in 20uL buffer P2 (Lonza) with 4μM IDT electroporation enhancer ...
-
bioRxiv - Immunology 2022Quote: ... Thawed PBMCS were rested for 3-4h at 37°C in X-VIVO 15 Serum-free Hematopoietic Cell Medium (Lonza) supplemented with 5% human Ab serum ...
-
bioRxiv - Biochemistry 2019Quote: ... 3×107 cells were transfected with 10 μg of NotI linearized plasmids using the AMAXA electroporator (Lonza, program X-001) as described [14] ...
-
bioRxiv - Genetics 2020Quote: ... ∼1×106 cells were transfected with pairs of 5 µg gRNA plasmid and 4 µg ssODN (Supplementary Table 3) using AmaxaTM Human CD34 Cell NucleofectorTM Kit (Lonza) in the 2B-NucleofectorTM on the U-08 setting ...
-
bioRxiv - Neuroscience 2020Quote: ... The spinal cord was spun at 3000 rpm for 3 min at room temperature after which the embryonic medium was replaced with 1x trypsin-EDTA (Lonza). The tissue was macerated in trypsin and incubated at 37°C for 15-20 mins ...
-
bioRxiv - Molecular Biology 2020Quote: ... at Day 3-4 of phase I culture were electroporated using P3 Primary Cell 4D NucleofectorTM X Kit (from Lonza) with program DZ100 (Bak et al. ...
-
PSGL-1 inhibits HIV-1 infection by restricting actin dynamics and sequestering HIV envelope proteinsbioRxiv - Microbiology 2020Quote: ... 1×106 activated CD4+T cells were stimulated by IFN-γ for 24 h before being transfected with 3 siRNAs following Amaxa Nucleofector following the manufacturer’s protocols (Lonza). Two days post transfection ...
-
bioRxiv - Cell Biology 2022Quote: ... and diseased COPD human lung fibroblasts (DHLFs) from 3 donors (donor IDs: OF3353, OF3418 and OF3238) were purchased from Lonza and tested for their response to FGF2 and TGFβ stimulation.
-
bioRxiv - Cancer Biology 2022Quote: ... and then combined with 3 µL of RNP mixture and nucleofected using program DJ-110 (melanoma) or EH100 (TILs) on a 4D Nucleofector (Lonza). Melanoma cells were immediately recovered in full melanoma media in 12-well plates ...
-
bioRxiv - Immunology 2021Quote: ... 2.106 T cells were resuspended in 20 µl of nucleofection solution with 3 µl or 4 µl RNP and transferred to Nucleofection cuvette strips (4D-Nucleofector X kit S; Lonza). Murine T cells were electroporated using the DN110 program of 4D nucleofector (4D-Nucleofector Core Unit ...
-
bioRxiv - Immunology 2019Quote: ... A20 and A20 D1.3 B cells (3 × 106cells) were transiently transfected using the AMAXA nucleofector kit V (Lonza, #VCA-1003) or the Ingenio electroporation kit (Mirus ...
-
bioRxiv - Microbiology 2021Quote: ... The human lung epithelial cell line Calu-3 (ATCC HTB-55) was maintained in DMEM F-12 (Lonza, Basel, Switzerland) supplemented with 10% FBS ...
-
bioRxiv - Bioengineering 2023Quote: Ha deposition was detected staining constructs sections (n≥10 from n≥3 chambers considering two different hACs and two different MSCs donors) with OsteoImage (Lonza) as detailed above ...
-
bioRxiv - Developmental Biology 2023Quote: ... 5.0-8.0 × 105 BTAG cells were electroporated with 3 μg of each gRNA using Amaxa 4D nucleofector (Lonza, V4XP-3012) and the CA-137 program ...
-
bioRxiv - Developmental Biology 2023Quote: iPSCs were transfected with sgRNA 3’ UCCCUUUCCUCAGGUCACAG 5’ (Synthego) via nucleofection using program CA137 on a 4D Nucleofactor X (Lonza) as per manufacturer’s instructions ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... The PCR products were then loaded and migrated by electrophoresis on a 3% Tris-borate-EDTA (TBE) agarose gel supplemented with GelStar Nucleic Acid Gel Stain (Lonza) for approximately one hour ...
-
bioRxiv - Immunology 2024Quote: ... They were then transfected by nucleofection with 3 μg of plasmid DNA in 100 μl of Cell Line Nucleofector Solution V (Lonza) using the V-001 program (Amaxa Biosystems) ...
-
bioRxiv - Cell Biology 2020Quote: ... HPAEC cells were procured from Lonza (catalog # CC-2530) and cultured in Endothelial Basal Media-2 (Lonza catalog #: CC-3516) supplemented with endothelial growth factors optimized for aortic and pulmonary arterial endothelial cells (Lonza catalog # CC-3162) ...
-
bioRxiv - Molecular Biology 2021Quote: ... HEK293T cells (2 × 105) were resuspended with SF buffer (V4XC-2032, Lonza, Basel, Switzerland) and pulsed with purified SpyCas9 (20 pmol).
-
bioRxiv - Physiology 2019Quote: HPMVECs were cultured in Microvascular Endothelial Cell Growth Medium-2 (EGM™-2MV, Lonza). TGF-β2 (2.5 ng/mL) ...
-
bioRxiv - Immunology 2020Quote: ... and transduced with lentivirus to express CAR (MOI=2) in X-VIVO 15 (Lonza) containing 10% FCS with 5 μg/mL protamine sulfate (APP Pharmaceuticals) ...
-
bioRxiv - Genomics 2019Quote: Bone marrow aspirates (donor n = 2, female, ages 22 & 24) were purchased from LONZA and hMSCs were isolated by adherence to tissue culture flasks for 24 hours ...
-
bioRxiv - Cell Biology 2020Quote: ... were grown in EGM-2MV (Microvascular Endothelial Cell Growth Medium-2) medium from Lonza Bioscience ...
-
bioRxiv - Immunology 2021Quote: ... coated dishes (5 ng/cm2) and cultured in Endothelial Growth Medium 2 (EGM2, Lonza) supplemented with 50 ng/mL VEGF with medium changes every other day until they reached confluency ...
-
bioRxiv - Bioengineering 2021Quote: ... 2 mM L-glutamine and 50 units/ml penicillin/streptomycin (cDMEM; Lonza, Slough, UK). Soluble foam proteins were prepared as above ...
-
bioRxiv - Bioengineering 2021Quote: ... were maintained in 0.1% (w/v) gelatin-coated flasks with complete EGM-2 (Lonza) supplemented with 1% penicillin-streptomycin (Gibco) ...
-
bioRxiv - Bioengineering 2021Quote: ... Then cells were cultured in differentiation medium I consisting EBM-2 (Lonza, #CC-3156), 0.1% FBS ...
-
bioRxiv - Genetics 2021Quote: ... The cells were electroporated by using the Human Stem Cell Nucleofector Kit 2 (Lonza) and the Nucleofector 2b Device (Lonza) ...
-
bioRxiv - Cell Biology 2021Quote: ... Talin1&2 double null cells (Atherton et al. 2015) were cultured in DMEM:F12 (Lonza) supplemented with 10% FCS (Lonza) ...
-
bioRxiv - Cancer Biology 2022Quote: ... the culture medium was replaced with 2 mL of DMEM-F12 (LONZA #12-719F) supplemented with 10 % FBS ...
-
bioRxiv - Neuroscience 2020Quote: ... Control HUVEC and HUVEC Nucleolin KD were cultured in the EGM-2 medium (Lonza), at 37°C with 5% CO2 ...
-
bioRxiv - Microbiology 2020Quote: ... Hep-2 cells were cultured in Dulbecco’s Modified Eagle Medium (DMEM; Lonza or Gibco) supplemented with 10% FBS ...
-
bioRxiv - Bioengineering 2022Quote: ... were cultured in EBM-2 endothelial cell growth basal medium (Lonza, Bend, OR, USA) supplemented with EGM-2MV microvascular endothelial cell growth medium SingleQuots supplements (Lonza) ...
-
bioRxiv - Molecular Biology 2021Quote: ... PCR reactions were run on a 2% agarose gel (NuSieve™ GTG™, Lonza) and the 200-400 bp region was excised and purified using a QIAquick Gel Extraction Kit (#28704 ...