Labshake search
Citations for Lonza :
751 - 800 of 947 citations for 1 Methoxy 4 1 methylbutyl benzene since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2023Quote: Cell and organoid lines were generated from C3-TAg tumors (supplementary file 1) and tested for mycoplasma (Lonza, LT07-703) prior to use and the creation of frozen stocks ...
-
bioRxiv - Microbiology 2023Quote: ... Knock-down procedures were performed with siRNA purchased from Riboxx (non-targeting siRNA: UUGUACUACACAAAAGUACCCCC; US10 targeting #1: UUCUGAAUAACACAGCCGCCCCC) applying the SE Cell Line Kit (Lonza) for fibroblasts and Lipofectamine RNAiMax (Invitrogen ...
-
bioRxiv - Microbiology 2023Quote: ... Ribonucleoproteins were introduced into 1 x 106 sub-confluent BLaER1 cells using 4D-Nucleofector X Unit and SF Cell line Kit (Lonza), applying program DN-100 ...
-
bioRxiv - Physiology 2023Quote: ... 2 μl of KCNQ2/3 cDNA plasmid (0.9 g/l) and 1 μl of pmax green fluorescent protein vector (0.5 g/l) (Lonza, Cologne, Germany) were diluted in 125 μl of Opti-MEM medium (Life Technologies) ...
-
bioRxiv - Molecular Biology 2023Quote: ... 5-6 million primary human keratinocytes were electroporated with 1 nmol siPools using the Amaxa human keratinocyte Nucleofector kit (Lonza) according to the manufacturer’s instructions and the T-018 program of the Amaxa Nucleofector II device (Lonza) ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... Measured tissues originated from six F508del homozygous patients (CF patient #1: CF-AB0609, female, 31 years-old; CF patient# 3: #28388-0000450918, Lonza, male ...
-
bioRxiv - Synthetic Biology 2023Quote: ... and 100 μL of YEA medium containing 1% (w/v) microwave-heated low-melting point agarose (SeaPlaque agarose, 50101; Lonza) was gently added to the central area ...
-
Cancer-associated fibroblasts produce matrix-bound vesicles that influence endothelial cell functionbioRxiv - Cancer Biology 2023Quote: ... HUVECs and HMVECs were cultured on 1% gelatin coated dishes in EGM-2 or EGM-2 MV (Lonza, Basel, Switzerland), respectively ...
-
bioRxiv - Cell Biology 2023Quote: ... were delivered as a ribonucleoprotein complex with the DNA donor template using a Nucleofector 2b Device and the Human Stem Cell Nucleofector Kit 1 (Lonza) following manufacturer’s instructions ...
-
bioRxiv - Genomics 2023Quote: ... of the PCR products were analyzed by electrophoresis on a 2% Agarose S gel (Nippon gene) in 1× TBE buffer and stained with GelStar (Lonza). The remaining PCR product of the condition that displayed a single-band or near single-band product on the gel was double size-selected and purified using AMPure XP beads (Beckman coulter ...
-
bioRxiv - Molecular Biology 2023Quote: ... 1×105 cells were grown in each well of 12 well culture plates in SkGM-2 BulletKit growth medium (Lonza) to >90% confluency under standard culture conditions of 37°C and 5% CO2 ...
-
bioRxiv - Neuroscience 2023Quote: ... and the ssODN (1 μl; stock 100 μM, IDT) in 20 μl of nucleofection buffer P3 (P3 Primary Cell NucleofectorTM Solution, Lonza) were nucleofected (program CA137 ...
-
bioRxiv - Neuroscience 2023Quote: ... reprogramming was initiated by nucleofection of 1×105 fibroblast with 1 µg of each episomal plasmid (pCXLE-hUL, pCXLE-hSK and pCXLE-hOCT4) using the Nucleofector 2b (Lonza). Initially ...
-
bioRxiv - Biophysics 2023Quote: ... MCF7 and A375 cells (ATCC) were transfected with 1 μg DNA using the SF Cell Line 4D-Nucleofector kit (Lonza) following the manufacturer’s instructions via electroporation (4D-Nucleofector ...
-
bioRxiv - Molecular Biology 2023Quote: ... MRTF-WT and MRTF knockout in NIH 3T3 (MRTF-KO-1 and MRTF-KO-2) cells were cultured in DMEM (BE12-614Q, Lonza) supplemented with 10 % Fetal Bovine Serum (FBS ...
-
bioRxiv - Molecular Biology 2023Quote: ... A cell count ranging from 1 × 10^5 to 2 × 10^5 cells was collected and suspended in 15 µL of nucleofection buffer (Lonza). Electroporations were conducted in the strip format ...
-
bioRxiv - Immunology 2023Quote: ... CTLs derived from LifeAct-GFP expressing pmel-1 mice were incubated with peptide-loaded and IFNγ-treated B16 cells cultured in phenol red-free DMEM (Lonza) supplemented with 10% FBS on stage at 37°C ...
-
bioRxiv - Developmental Biology 2023Quote: ... An mTmG lens carrying the MLR39-Cre allele was placed in a small hole in the center of an agarose pad that was prepared by loading 1 mL of 2% agarose (SeaKem GTG, Lonza) in M199 on the surface of 35 mm glass-bottom dish (3970-035 ...
-
bioRxiv - Cell Biology 2023Quote: ... and performed nucleofection where 1 × 106 of the selected clone were resuspended in 100 μl of P3 buffer (V4XP-3024, Lonza) containing 20 μg Alt-R® S.p ...
-
bioRxiv - Biochemistry 2024Quote: Agarose gel electrophoresis was run in horisontal mode using a home-built apparatus as described.39 All the samples and the gels (1% (w/v) Sea Kem LE Agarose from LONZA Bioscience ...
-
bioRxiv - Immunology 2024Quote: ... insert and placed in one well of a six-well plate in 1 ml serum free culture medium (“RB27”) composed of RPMI 1640 (Lonza), 4% B27 supplement (Thermo Fisher Scientific) ...
-
bioRxiv - Biophysics 2024Quote: ... or 5-twist alone) were isolated by the separation of nicked knot reactions in 1% low-melting point agarose gels (SeaPlaque agarose, Lonza), followed by excision of specific bands ...
-
bioRxiv - Neuroscience 2024Quote: ... 2 mg Cas9-gRNA-2 plasmid and 1 mg eGFP-puromycin resistance plasmid using the Amaxa 4D-Nucleofector system (Lonza) according to the manufacturer’s instructions with a pulse load of CA137 ...
-
bioRxiv - Molecular Biology 2024Quote: ... The cells were first electroporated with a PiggyBac-configured plasmid containing the Dox-inducible NbALFA-ABEL degrader cassette and a plasmid encoding the PiggyBac transposase at a 3:1 mass ratio via nucleofection (solution E with program CM138) according to manufacturer’s instructions (Lonza Inc.), followed by puromycin selection (5μg/ml ...
-
bioRxiv - Genetics 2024Quote: One to two million cells from juvenile testes or two to three million cells from adult testes were embedded in plugs of 1% low-melting-point agarose (Lonza). After a brief incubation at 4 °C until the agarose became solid ...
-
bioRxiv - Immunology 2024Quote: ... 3µL of gRNA was mixed with 1µL electroporation enhancer (IDT 1075915) and 20µL of Jurkat T cells (1 x 105) in nucleofection solution (Lonza V4XC-1032). The mixture was transferred to a 16-well Nucleocuvette Strip and electroporated with the 4D-Nucleofector (Lonza ...
-
bioRxiv - Synthetic Biology 2024Quote: ... The optimised sequences were used to design gBlocks with appropriate overhangs (Fig. 1-3) and cloned into pMAX-GFP plasmid from Lonza, digested with KpnI and SacI (Fig ...
-
bioRxiv - Immunology 2024Quote: ... PBMC vials were thawed in the 37 °C water bath for 1-2 minutes and resuspended in warm X-VIVO 10 serum-free cell-media (Lonza). Samples were washed by centrifugation for 12 minutes at 1200 rpm at room temperature (RT) ...
-
bioRxiv - Genetics 2024Quote: ... T cells were centrifuged for 10 minutes at 90g and re-suspended in 1-2e6 T cells per 20 uL P3 Buffer (Lonza) and mixed with prepared Cas9 ribonucleoprotein (RNP ...
-
bioRxiv - Cancer Biology 2024Quote: ... with 2 μg pMito-iRFP670-FRB and 1 μg of the required GFP–FKBP (Ctrl or -Rab25) using programme A-23 (Lonza). The following day ...
-
bioRxiv - Bioengineering 2024Quote: SP8 or DP T cells were isolated as described above and stimulated in vitro using irradiated K562 CD19-CD137L aAPCs at a 1:3 aAPC:T cell ratio in X-VIVO™ 15 (Lonza), supplemented with 5% human AB serum (Cat ...
-
bioRxiv - Cell Biology 2020Quote: ... Transfections for specific recombination in TCIS clones were performed with the electroporation system (Amaxa Nucleofector 4; Lonza), to ensure essentially 100% transfection efficiency ...
-
bioRxiv - Bioengineering 2021Quote: Human bone marrow-derived MSCs were obtained from 4 different donors purchased from Lonza (Walkersville, MD, USA), AllCells (Emeryville ...
-
bioRxiv - Cell Biology 2021Quote: ... Passaging of iPSCs was carried out every 4-5 days using Versene (EDTA 0.02%) (Lonza, BE17–771E) solution for 3–5⍰minutes at 37⍰°C ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... Sf9 cells (4 × 105 cells* ml) in 2 ml of Insect-Xpress medium (Lonza, Walkersville, MD, USA) were transfected with recombinant bacmids using Cellfectin reagent (Life Technologies) ...
-
bioRxiv - Neuroscience 2022Quote: ... GFP expression plasmid was inserted into CAP-exosomes using 4-D-Nucleofector (instruments and reagents from Lonza, Basel ...
-
bioRxiv - Cell Biology 2021Quote: ... immature RPE cells were seeded at a density of 1 × 105 cells/cm2 onto growth factor reduced ECMH (Corning)-coated transwells and allowed to be mature for 4-6 weeks in RPE medium (XVIVO 10, Lonza). Matured RPE at P1 or P2 were used in downstream experiments.
-
bioRxiv - Cell Biology 2022Quote: ... ∼2-4 million cells were electroporated using the T020 method of the Nucleofector™ 2b device (Lonza). Immediately after electroporation ...
-
bioRxiv - Cancer Biology 2023Quote: ... using the P3 Primary Cell 4D-Nucleofector X Kit for Amaxa 4-D device (Lonza, #V4XP-3032). 2×10E5 cells per condition were nucleofected in separated strip wells using program EO-100 ...
-
bioRxiv - Immunology 2023Quote: ... and the two lobes were separated and embedded in 4% low melting point agarose (Lonza, NJ, USA). 400µm thymic slices were generated by slicing the trimmed agarose blocks on a VT 1000S vibratome (Leica ...
-
bioRxiv - Biochemistry 2023Quote: ... ∼2-4 million cells were electroporated using the T020 method of the Nucleofector™ 2b device (Lonza). Immediately after electroporation ...
-
bioRxiv - Cell Biology 2024Quote: ... were used in passages 4-8 and expanded in flasks in Fibroblast Basal Medium (Lonza, #CC-3131) with FGM2-Fibroblast Growth Medium BulletKit (Lonza ...
-
bioRxiv - Developmental Biology 2024Quote: ... The nucleofection process was carried out using the DN100 program on the Amaxa 4-D Nucleofector (Lonza).
-
bioRxiv - Cell Biology 2020Quote: BMDMs (1 × 106 cells) were transfected with siRNA (250 pmol) and Amaxa Mouse Macrophage Nucleofector Kit (Lonza, catalog number VPA-1009) using a Lonza Nucleofector 2b device (Lonza ...
-
bioRxiv - Genomics 2021Quote: ... Four aliquots of one million cells each per study subject were stimulated overnight for 12 hours in 1 ml X-VIVO™ 15 Serum-free Hematopoietic Cell Medium (Lonza) with 10 ul ImmunoCult™ Human CD3/CD28/CD2 T Cell Activator (STEMCELL Technologies) ...
-
bioRxiv - Immunology 2021Quote: ... The frequency of cells producing IFN-γ in responses to antigen was quantified with ELISpot (Diaclone; 2B Scientific, Oxon, U.K.) performed in HL-1 serum-free medium (BioWhittaker; Lonza, Slough, U.K.), supplemented with L-glutamine and penicillin–streptomycin (Life Technologies ...
-
bioRxiv - Plant Biology 2021Quote: ... pollen was collected immediately prior to bombardment and distributed on pollen germination medium solidified with 1% (w/v) NuSieve GTG Agarose (Lonza, Switzerland). Pollen germination media for Nicotiana (Wang and Jiang 2011 ...
-
bioRxiv - Microbiology 2021Quote: ... Vero cell cultures were seeded at 1-3 × 104 cells/cm2 in Dulbecco’s minimal essential medium (DMEM, LONZA, Alpharetta, GA, USA) supplemented with 9% foetal bovine serum (FBS ...
-
bioRxiv - Biophysics 2020Quote: ... or in Binding buffer (1% w/v BSA and 25 mM HEPES pH 7.2 in DMEM without phenol red; Lonza Netherlands B.V.) at 4°C in the case of HeLa cells ...
-
bioRxiv - Genomics 2022Quote: ... 20 ng of HMW DNA was run on a 1% agarose gel (Seakem Gold Agarose, Lonza, Rockland, ME, USA, Cat #50150) in 0.5xTBE with the BioRad CHEF Mapper system (BioRad ...