Labshake search
Citations for Lonza :
7751 - 7800 of 9615 citations since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Bioengineering 2020Quote: ... Cells were routinely tested for mycoplasma every 6 months to ensure cell quality (MycoAlert™ Mycoplasma Detection Kit; Lonza).
-
bioRxiv - Bioengineering 2020Quote: ... cells were cultured in Hepatocyte Basal Medium (Lonza CC-3199) supplemented with all components of Hepatocyte Culture Medium SingleQuots except EGF (Lonza CC-4182 containing gentamicin-amphotericin ...
-
bioRxiv - Bioengineering 2020Quote: ... supplemented with all components of Hepatocyte Culture Medium SingleQuots except EGF (Lonza CC-4182 containing gentamicin-amphotericin ...
-
bioRxiv - Biophysics 2020Quote: ... were maintained in growth medium EGM-2MV (Lonza) medium supplemented with 10% (v/v ...
-
bioRxiv - Biophysics 2020Quote: ... we added buffer (2 μL 10x MOPS buffer, Lonza) and loading dye (8 μL ...
-
bioRxiv - Biophysics 2020Quote: ... We validated the size and integrity of cRNAs using gel electrophoresis (Reliant®RNA Gels, 1.25% SKG, Lonza). To each cRNA sample ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... D Drucker) were routinely cultured in Dulbecco’s modified eagle medium (DMEM) (5.5 mmol/L D-glucose) (Lonza, UK), supplemented with 10% (v/v ...
-
bioRxiv - Biophysics 2020Quote: Human mesenchymal stem cells (PT-2501) used for proof-of-principle dSTORM imaging were purchased from Lonza Group ...
-
bioRxiv - Biophysics 2020Quote: ... ∼300 pairs of ovaries were harvested from 3-6 day old females in 1X PBS (Lonza) with 1 mM DTT (Sigma ...
-
bioRxiv - Cell Biology 2020Quote: ... NJ) and were cultured in in EGM-2 (Lonza, CC-3162). Adult human dermal fibroblasts (HDFs ...
-
bioRxiv - Cell Biology 2020Quote: Human umbilical vein endothelial cells (HUVECs) were from Lonza (Allendale, NJ) and were cultured in in EGM-2 (Lonza ...
-
bioRxiv - Biophysics 2020Quote: ... or in Binding buffer (1% w/v BSA and 25 mM HEPES pH 7.2 in DMEM without phenol red; Lonza Netherlands B.V.) at 4°C in the case of HeLa cells ...
-
bioRxiv - Cell Biology 2020Quote: ... Nucleofection (Nucleofector 2B, Lonza) was performed in a 0.2 cm gap cuvette (Bio-Rad ...
-
bioRxiv - Cell Biology 2020Quote: ... The pPBbsr-based FRET biosensor and pCMV-mPBase (neo-) encoding the piggyBac transposase were co-transfected into MDCK cells using an Amaxa nucleofector system (Lonza, Basel, Switzerland) at a ratio of 4:1 ...
-
bioRxiv - Cell Biology 2020Quote: ... 20% FCS (Lonza), 2 mM L-Glutamine ...
-
bioRxiv - Cell Biology 2020Quote: ... MDA-MB-231 cells were transfected with RFP-pericentrin via a 4D nucleofector system (Lonza) prior to seeding in glass bottom dishes and siRNAs were added 24 hours later ...
-
bioRxiv - Cell Biology 2020Quote: ... Transfections were performed using a 4D nucleofector system (Lonza) and plated on to 12-mm glass coverslips ...
-
bioRxiv - Cell Biology 2020Quote: ... and P3 primary cell nucleofection buffer (Lonza). Nucleofection was performed according to the instructions of IDT with Nucleofection enhancer ...
-
bioRxiv - Cell Biology 2020Quote: ... The cells were counted using a Neubauer chamber and 200.000 cells per nucleofection sample were prepared according to the manufacturer’s instruction using a Nucleocuvette (Lonza) and P3 primary cell nucleofection buffer (Lonza) ...
-
bioRxiv - Cell Biology 2020Quote: ... iPSCs were resuspended in nucleofection solution 2 (Amaxa; Lonza) with 10 μg of donor plasmid and 3 μg of ZFN messenger RNA per 2 × 106 cells ...
-
bioRxiv - Cell Biology 2020Quote: ... complex containing Alt-R HiFi Cas9 Nuclease (IDT) and a tracrRNA:crRNA duplex (crRNA sequence: GGTCGTTGAGGACTTCCACA) using program CM150 of the Amaxa 4D Nucleofector (Lonza). Briefly ...
-
bioRxiv - Cell Biology 2020Quote: ... were resuspended at a density of 6×106 cells mL−1 in Microvascular Endothelial Cell Growth Medium-2 media (EGM-2MV, Lonza). The bottom channel of the chip was washed with EGM-2MV and loaded with 6 μL of HIMEC cell suspension (~36,000 cells per chip) ...
-
bioRxiv - Cell Biology 2020Quote: ... chemically-defined medium (BioWhittaker Pro293a-CDM, Lonza) with 1× GlutaMAX (100× stock ...
-
bioRxiv - Cell Biology 2020Quote: ... aliquots of obtained BM aspirates were seeded into cell culture flasks containing endothelial basal media (EBM-2, Lonza, Cologne, Germany) supplemented with 10% human platelet lysate (PL ...
-
bioRxiv - Cell Biology 2020Quote: ... and 100 U/ml penicillin/streptomycin (Lonza) in a humidified atmosphere containing 5% CO2 at 37°C.
-
bioRxiv - Cell Biology 2020Quote: ... supplemented with 15% FBS (Mef Abl-/-) or 10% FBS (for MCF7) (Lonza) and 100 U/ml penicillin/streptomycin (Lonza ...
-
bioRxiv - Cell Biology 2020Quote: ... Jurkat T cells were transfected using the Amaxa Cell Line Nucleoefector Kit V (Lonza, VCA-1003). Transient transfections were performed as follows ...
-
bioRxiv - Cell Biology 2020Quote: ... Cultures were routinely tested for mycoplasma contamination using MycoAlert Kit (Lonza). Cells were dissociated into small aggregates using ReLeSR (STEMCELL technologies ...
-
bioRxiv - Cell Biology 2020Quote: ... were cultured following provider’s instructions (Lonza). Finally ...
-
bioRxiv - Cell Biology 2020Quote: ... Human Skeletal Muscle Myoblasts (HSMM) (CC-2580, Lonza) were cultured following provider’s instructions (Lonza) ...
-
bioRxiv - Cancer Biology 2020Quote: ... Cell lines were routinely tested for Mycoplasma at least monthly (MycoAlert Detection Kit, Lonza).
-
bioRxiv - Cancer Biology 2020Quote: ... supplemented with 5% decomplemented FBS (Lonza), 1 M HEPES (Sigma) ...
-
bioRxiv - Cancer Biology 2020Quote: ... supplemented with 10% decomplemented FBS (Lonza), 2 mM L-glutamine (Sigma ...
-
bioRxiv - Cancer Biology 2020Quote: ... Mouse endothelial cells from brain microvessels (bEND3) were maintained in DMEM (Lonza) supplemented with 10% decomplemented FBS (Lonza) ...
-
bioRxiv - Cancer Biology 2020Quote: Performing an anchorage-independent growth assay using SeaPlaque agarose (Lonza, catalog number 50101), we assessed the transformation capacity of the 67NR-S and 67NR-NS cells in vitro ...
-
bioRxiv - Cancer Biology 2020Quote: ... 1 μg of each pX330-gRNA plasmid plus 0.1 μg of pmaxGFP plasmid (Lonza) were transiently transfected into exponentially growing cells using Lipofectamine 2000 (Invitrogen) ...
-
bioRxiv - Genomics 2020Quote: ... Human umbilical vein endothelial cells were isolated from umbilical cords of healthy donors after cesarean sections (HUVECS; n = 4; RWTH Aachen) (55) or obtained from Lonza (n = 3, Basel, Switzerland) (8) ...
-
bioRxiv - Immunology 2020Quote: ... 5 µg of NOSIP shRNA plasmids or control TRC2 plasmid was mixed with 100 µl Cell Line Nuceleofector Solution V (Lonza) and added to one million cells ...
-
bioRxiv - Microbiology 2020Quote: Normal Human Dermal Fibroblasts (NHDFs; purchased from Lonza, Walkersville, MD) were grown in DMEM supplemented with 5% Fetal Bovine Serum ...
-
bioRxiv - Biochemistry 2020Quote: ... supplemented with 6.6 % FCS and 33 % EBM™-2 Endothelial Cell Growth Basal Medium-2 (Lonza, Basel, Switzerland). HELA cells (DSMZ ACC-57 ...
-
bioRxiv - Microbiology 2020Quote: ... chromosomes were separated on 1% SeaKem® Gold Agarose (Lonza) in 0.5×TBE buffer at 4 to 7 °C for 260 h using a CHEF Mapper System (Bio-Rad) ...
-
bioRxiv - Neuroscience 2020Quote: ... fresh human foetal brain tissue was chopped mechanically and dissociated with Trypsin (LONZA; BE17-161E) 1:5 in growth medium for 5-10 min at 37°C ...
-
bioRxiv - Neuroscience 2020Quote: ... the cells were cultured in maturation medium AGMTM Astrocyte Growth Medium BulletKit™ (Lonza, CC-3186) as described in Table S2 ...
-
bioRxiv - Microbiology 2020Quote: ... siRNA was transfected with Amaxa cell line nucleofector kit and Nucleofector II (Lonza) according to the manufacturer’s protocol.
-
bioRxiv - Cell Biology 2020Quote: ... 0.1 mg/mL penicillin/streptomycin (Lonza), and 30 µg/ml blasticidin ...
-
bioRxiv - Neuroscience 2020Quote: Primary rat hippocampal neurons were prepared as described previously39) Cultured neurons were transfected with pCAG-FR-GECO1a and pCAG-FR-GECO1c plasmids using electroporation (Lonza Nucleofector) according to manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2020Quote: ... Fractions were pooled and buffer-exchanged to phosphate-buffered saline (PBS; 140 mM NaCl, 5 mM NaH2PO4, 5 mM Na2HPO4, pH 7.4; Lonza, UK) using a Sephadex G-25 column (GE Healthcare ...
-
bioRxiv - Neuroscience 2020Quote: ... Control HUVEC and HUVEC Nucleolin KD were cultured in the EGM-2 medium (Lonza), at 37°C with 5% CO2 ...
-
bioRxiv - Neuroscience 2020Quote: ... HUVECs were cultured in endothelial basal medium (EBM-2) supplemented with endothelial growth factors EGM-2 SingleQuots (Lonza).
-
bioRxiv - Microbiology 2020Quote: ... and the pellet was resuspended in 20 µl of room temperature P3 electroporation buffer (Lonza, Basel, Switzerland) per reaction ...