Labshake search
Citations for Lonza :
701 - 750 of 1997 citations for Cortisol ELISA Kit 5 Whole Plate since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2024Quote: ... and cultured in the appropriate media (SKBM-2 Bullet kit, Lonza, Basel ...
-
bioRxiv - Cell Biology 2024Quote: ... The Amaxa Mouse Macrophage Nucleofector Kit was from Lonza (Cologne, Germany). Gene-specific TaqMan primer-probe mixes used for quantitative real-time polymerase chain reaction (PCR ...
-
bioRxiv - Molecular Biology 2024Quote: ... Cell lines were monthly tested for mycoplasma using MycoAlert Kit (Lonza) and were sent for authentication by Eurofins genomics.
-
bioRxiv - Bioengineering 2024Quote: ... Cells were screened for mycoplasma using MycoAlert Mycoplasma Detection Kit (Lonza). The medium was removed and the cells were washed twice with warm PBS and fixed with 4% paraformaldyhde ...
-
bioRxiv - Cancer Biology 2024Quote: ... Mycoplasma detection was routinely performed using the MycoAlert detection kit (Lonza) throughout this study ...
-
bioRxiv - Cell Biology 2024Quote: ... Cell clumps were electroporated using Mouse/Rat Hepatocyte NucleofectorTM Kit (Lonza) and Amaxa Nucleofector® 1 device in the presence or absence of flagellin (1μg ...
-
bioRxiv - Cell Biology 2024Quote: ... along with the Human Stem Cell Nucleofector™ Kit 2 (Lonza). Briefly ...
-
bioRxiv - Cancer Biology 2024Quote: ... or by analysis with MycoAlert Mycolplasma Detection Kit (Lonza, LT07-418).
-
bioRxiv - Cancer Biology 2020Quote: ... All cell lines were cultured at 37°C and 5% CO2 in DMEM (H3BE12-604F/U1, Lonza Group AG [Cultek S.L.U, Madrid, Spain]) supplemented with 10% tetracycline-free FBS (631106 ...
-
bioRxiv - Molecular Biology 2021Quote: ... and Alt-R™ HDR donor oligo 5’ GTGTTTAGAAAAAAAAGAGTGTTTTTTTACCAGGGCCTTTGGCTCTTCCAGGAAGCAGATGTCCGAGTCGGAATATAATAACCCTTTCATACTCTTG 3’ (PS modification, antisense; IDT) using a 4D-nucleofector System X Unit (Lonza, Basel, Switzerland) and the P3 primary Cell 4D-Nucleofector® X kit (#V4XP-3024 ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... Cells are spun at 1250 x g for 5 minutes and resuspended in 25 µl Lonza SF buffer (Lonza Cat. No. V4SC-2960) if cycloheximide selection will not be used or 200 µl of SF buffer if cycloheximide selection will be used.
-
bioRxiv - Molecular Biology 2023Quote: ... were grown in 10 cm2 dishes in a humidified environment at 37°C with 5% CO2 in DMEM/F12 medium (Lonza Ltd. Basel, Switzerland) supplemented with 10% fetal bovine serum (FBS ...
-
bioRxiv - Molecular Biology 2023Quote: ... were expanded in 10 cm2 dishes in a humidified environment at 37°C with 5% CO2 in DMEM/F12 medium (Lonza Ltd. Basel, Switzerland) supplemented with 12.5% fetal bovine serum (FBS ...
-
bioRxiv - Microbiology 2023Quote: ... plates were incubated at 37°C for 30 minutes in blocking buffer (PBS with 1% BSA, 5% FBS, and 1% human AB serum (Lonza, Walkersville, MD, USA), washed three times in PBS with 0.05% tween 20 and incubated with a commercial anti-SARS-CoV-2 Spike antibody (1/1000 ...
-
bioRxiv - Cell Biology 2023Quote: ... cultured for 48 h at 37°C with 5% CO2 in EGM™-2 Endothelial Cell Growth Medium-2 BulletKit™ (Lonza, UK) with penicillin–streptomycin (100_U/ml ...
-
bioRxiv - Cell Biology 2023Quote: ... cultured for 48 h at 37°C with 5% CO2 in EGM™-2 Endothelial Cell Growth Medium-2 BulletKit™ (Lonza, UK) with penicillin–streptomycin (100_U/ml ...
-
bioRxiv - Cell Biology 2023Quote: ... The cells were used from passages 5-9 for the experiments and were cultured in endothelial cell growth Medium-2 (EGM™-2) Bulletkit™ (Lonza Bioscience) on pretreated tissue culture 6-well plate (VWR international) ...
-
bioRxiv - Cancer Biology 2024Quote: ... 1×106 T cells were transfected with Cas9/RNPs complexes of CD38 targeting guide RNA 5’-AGUGUAUGGGAUGCUUUCAA -3’ (Synthego) using Lonza 4D-Nucleofector™ X Unit (Lonza, AAF-1003X). Transfection was carried out in P3 Primary Cell 4D-Nucleofector™ Solution (Lonza ...
-
bioRxiv - Immunology 2019Quote: ... mice were reconstituted 4 hrs post-irradiation with 5 million donor bone marrow cells in 200 μl Hank’s Balanced Salt Solution (HBSS; Lonza, distributed by VWR, Lutterworth, UK), administered by intravenous injection into the tail vein ...
-
bioRxiv - Genetics 2023Quote: ... of sg1617 or sg1618 was mixed with 500 pmol (5 μM) of 3xNLS-SpCas9-SpCas9 protein and added electroporation buffer (Lonza 4D, cat# V4XP-3024) up to 25 μl in one tube ...
-
bioRxiv - Genetics 2023Quote: ... of sg1617 or sg1618 (see sequences of sgRNAs in Table S2) was mixed with 100 pmol (5 μM) of 3xNLS-SpCas9 protein and added electroporation buffer (Lonza 4D, cat# V4XP-3032) up to 5 μl in one tube ...
-
bioRxiv - Bioengineering 2023Quote: Cells were cultured at 37°C and 5% CO2 in cell-specific media: primary human umbilical vascular endothelial cells (HUVECs, Lonza; up to passage 6) in EGM-2 (Lonza ...
-
bioRxiv - Neuroscience 2021Quote: ... with the P3 primary cell 4D nucleofector kit L (Lonza LONV4XP-3024). Puromycin (Invivogen 10 mg/ml ...
-
bioRxiv - Biophysics 2022Quote: ... Electroporation was performed using the Amaxa Cell Line Nucleofector Kit V (Lonza) using the P-20 program ...
-
bioRxiv - Genomics 2020Quote: ... or nucleofection (SG Amaxa Cell Line 4D-Nucleofector Kit, Lonza, Basel, Switzerland). Mutation efficiency was assessed in bulk cultures via DNA extraction ...
-
bioRxiv - Genomics 2020Quote: ... The cells were transfected using the Mouse ES Cell Nucleofector Kit (Lonza) and Amaxa Nucleofector (Lonza ...
-
bioRxiv - Cancer Biology 2019Quote: ... All cell lines were tested for mycoplasma using MycoAlert detection kit (Lonza), and fingerprinted by STR fingerprinting ...
-
bioRxiv - Developmental Biology 2019Quote: ... Fibroblasts were nucleofected using human dermal fibroblast nucleofector kits (Lonza, VPD-1001) with Amaxa nucleofector program U-023 ...
-
bioRxiv - Bioengineering 2019Quote: ... Chip medium was prepared by adding EGM-2 SingleQuot bullet kit (Lonza) to DMEM/F12 (Lifesciences) ...
-
bioRxiv - Pharmacology and Toxicology 2019Quote: ... and the SG Cell Line 4D-Nucleofector® X Kit L (Lonza) and reseeded ...
-
A quantitative analysis of the interplay of environment, neighborhood and cell state in 3D spheroidsbioRxiv - Systems Biology 2020Quote: ... Mycoplasma was not detected with a MycoAlert PLUS Mycoplasma Detection Kit (Lonza) in any of the cell lines.
-
bioRxiv - Cell Biology 2020Quote: ... Cells were tested for mycoplasma contamination with MycoAlert kit (LT07-418, Lonza) before use in experiments ...
-
bioRxiv - Biophysics 2020Quote: ... and transfected by nucleofection using Amaxa Kit R per manufacturer’s instructions (Lonza). Positive cells were amplified under antibiotic selection pressure and sorted for low or intermediate expression level of the fluorescently tagged protein on an Aria II Fluorescence Activated Cell Sorter (BD) ...
-
bioRxiv - Neuroscience 2020Quote: NPCs were collected in nucleofection solution (Amaxa Mouse NSC Nucleofector Kit, Lonza) and electroporated with 5e6 or 1e6 copies/cell of 5’ biotinylated 145bp AAV ITR ssDNA or scrambled control (ITR ...
-
bioRxiv - Bioengineering 2020Quote: ... Cell contamination was tested with a MycoAlert™ Mycoplasma Detection Kit (Lonza) and cells tested negative for mycoplasma.
-
bioRxiv - Molecular Biology 2021Quote: ... as previously described (3) and the Cell Line Nucleofector Kit R (Lonza). Briefly ...
-
bioRxiv - Cancer Biology 2020Quote: ... and confirmed to be mycoplasma-free using MycoAlert Mycoplasma Detection Kit (Lonza). The specific culture conditions for each cell line were listed in Supplementary Table 1.
-
bioRxiv - Cell Biology 2021Quote: The Amaxa Cell Line Nucleo-factor Kit R (L-013 program; Lonza) was used to electroporate 5 × 106 IIA1.6 B Lymphoma cells for different transfections ...
-
bioRxiv - Neuroscience 2022Quote: ... NSCs were transfected using the Amaxa NSC Nucleofector Kit (Lonza, VPG-1004) as previously described (Belenguer et al ...
-
bioRxiv - Cancer Biology 2022Quote: ... and were routinely tested for mycoplasma using MycoAlert mycoplasma detection kit (Lonza). HCC38 ...
-
bioRxiv - Microbiology 2022Quote: ... Cells were routinely checked for mycoplasma (MycoAlert Mycoplasma Detection Kit MycoAlert, Lonza) and FBS was assayed for endotoxin contamination before purchase58.
-
bioRxiv - Genomics 2022Quote: ... were cultured with renal epithelial cell growth medium kit (Lonza; CC-3190). Human telomerase reverse transcriptase (hTERT)-immortalized human RPTEC (ATCC ...
-
bioRxiv - Cancer Biology 2022Quote: ... HMLE cells were maintained in MEGM bullet kit (Lonza, no. CC-3150). All media were supplemented with 1 % penicillin and streptomycin.
-
bioRxiv - Biophysics 2022Quote: ... Electroporation was performed using the Amaxa Cell Line Nucleofector Kit V (Lonza) using the P-20 program ...
-
bioRxiv - Cell Biology 2022Quote: K562 cells were transformed by electroporation with Nucleofector Kit V (Bioscience, Lonza) according to the manufacturer’s protocol ...
-
ACE2-lentiviral transduction enables mouse SARS-CoV-2 infection and mapping of receptor interactionsbioRxiv - Microbiology 2021Quote: ... Cells were routinely checked for mycoplasma (MycoAlert Mycoplasma Detection Kit MycoAlert, Lonza) and FCS was assayed for endotoxin contamination before purchase (96) ...
-
bioRxiv - Cell Biology 2021Quote: Electroporation was performed using nucleofector kit V (Lonza, Cat. No. VCA-1003) and Amaxa nucleofector II electropotator (Lonza ...
-
bioRxiv - Cancer Biology 2020Quote: ... The clones were regularly tested using the MycoAlert Mycoplasma Detection Kit (Lonza).
-
bioRxiv - Immunology 2020Quote: ... using the SF Cell Line 4D-Nucleofector Kit L (Lonza, V4XC-2012) with the program CQ-104 ...
-
bioRxiv - Bioengineering 2021Quote: ... was used for K562s and the P3 Primary Cell 4D Kit (Lonza) was used for the unstimulated primary T cells ...