Labshake search
Citations for Lonza :
701 - 750 of 1194 citations for 3 Chloro 2 Trimethylsiloxypropene since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2024Quote: ... and 300μM single stranded oligodeoxynucleotides (ssODN: 5’gggtccagggtggctgtcactcat ccttttttctggctaccaaaggtgcagataattaaGaagaagctggatcttagcaacgtccagccaagtgtggctcaaaggataatatc aaacacgtcc 3’) and the P3 Primary Cell 4D reaction mix (Lonza). We screened a minimum of 96 clones for genetic editing ...
-
bioRxiv - Genetics 2024Quote: ... Approximately 2.5×105 CD34+ HSPCs were mixed with gRNA:Cas9 complexes and 3 µg ssDNA donor template (20 μL) in nucleofector strip format (Lonza). Electroporation was performed in Unit X ...
-
bioRxiv - Cell Biology 2024Quote: ... NHEKs (no later than passage 3) were cultured in KGM Gold Keratinocyte Growth Medium BulletKit (00192060, Lonza, Basel, Switzerland). For daily maintenance and subculturing of NHEKs ...
-
bioRxiv - Cell Biology 2020Quote: ... supplemented with the Endothelial Growth Medium (EGM-2) bullet kit (CC-3162, Lonza) and 1x antibiotic-antimycotic (Gibco) ...
-
bioRxiv - Cell Biology 2021Quote: ... Cells were cultured in Endothelial Cell Growth Medium-2 BulletKit (CC-3162, Lonza) with 100 U/ml Penicillin (Thermo Fisher Scientific ...
-
bioRxiv - Bioengineering 2021Quote: ... Cells were supplemented with EGM−-2 endothelial cell growth medium (Lonza, Basel, Switzerland). Cells were passage at 70 – 80 % confluency ...
-
bioRxiv - Bioengineering 2020Quote: ... were cultured with the Endothelial Cell Growth Medium-2 BulletKit (Lonza CC-3162) All cultures were maintained at 37°C ...
-
bioRxiv - Bioengineering 2020Quote: ... These cells were cultured and maintained in EGM-2 Bulletkit (CC-3162, Lonza). KLF2-GFP reporter cells were cultured M199 medium (12117F ...
-
bioRxiv - Cell Biology 2021Quote: ... Undifferentiated myoblasts were maintained in Skeletal Muscle Growth Media-2 (CC-3245; Lonza). 7.5 × 104 myoblasts were seeded on 30-mm dishes for immunocytochemistry ...
-
bioRxiv - Bioengineering 2021Quote: ... were grown in Fibroblast Growth Medium (FGM-2 BulletKit™, CC-3132, Lonza). Cells were cultured under a humidified incubator at 37°C and 5% CO2 and grown up to 80% confluency for experiments ...
-
bioRxiv - Microbiology 2020Quote: ... pre-warmed DMEM with 2 % FBS mixed with liquid SeaPlaque™ Agarose (Lonza) to a final concentration of 0.8 % agarose was added to cells two hours post infection ...
-
bioRxiv - Immunology 2020Quote: ... PBMCs were expanded for 2 weeks in X-vivo media (Lonza, BE02-060Q) supplemented with 5% human serum (Gibco ...
-
bioRxiv - Cancer Biology 2020Quote: ... Sorted cells were cultured in Endothelial Growth Media (EGM-2) (Lonza, Basel, Switzerland) on 2% gelatin-coated chamber slides ...
-
bioRxiv - Cancer Biology 2020Quote: ... 2 mM L-Glutamine and 100 U/ml Pen-Strep (all from Lonza). Cell lines were regularly tested for mycoplasma contamination ...
-
bioRxiv - Bioengineering 2022Quote: ... were obtained from Lonza (CC-2576) and cultured using SmGM™-2 BulletKit™ (Lonza CC-3182). All cells were from patients ranging in age from 30 to 65 years old and were sub-cultured according to Lonza’s recommended protocol.
-
bioRxiv - Biochemistry 2022Quote: ... grown to 1.6-2 million cells/ml in Insect-XPRESS media (Lonza™), were infected with P1 viral stocks at 16 ml/L ...
-
bioRxiv - Cell Biology 2022Quote: ... supplemented with the Endothelial Growth Medium (EGM-2) bullet kit (CC-3162, Lonza) and 1x antibiotic-antimycotic (Gibco) ...
-
bioRxiv - Genomics 2020Quote: ... The first consisted of 2 μl/well pmaxGFP DNA (LONZA,1 μg/ul) diluted in 250 μl/well Opti-MEM® medium (ThermoFisher Scientific ...
-
bioRxiv - Microbiology 2021Quote: ... HSC-2 (JCRB0622) cells were cultured in EMEM (Eagle’s Minimum Essential Medium; Lonza), while HO-1-N-1 (JCRB0831 ...
-
bioRxiv - Immunology 2020Quote: RAW264.7 and 293 TLR4/CD14/MD-2 cells were cultured in DMEM (Lonza) supplemented with 10 % FBS (Gibco ...
-
bioRxiv - Cell Biology 2020Quote: ... Samples were collected after two days in SKGM (SKGM-2, Lonza CC-3245) culture ...
-
bioRxiv - Cell Biology 2020Quote: ... supplemented with Endothelial Cell Growth Medium (EGM)-2 Bullet Kit (CC-3162; Lonza)) ...
-
bioRxiv - Cell Biology 2021Quote: ... The hMBs were maintained in Skeletal Muscle Growth Media-2 (CC-3245; Lonza) as a growth medium for hMBs (hMB-GM) ...
-
bioRxiv - Cancer Biology 2021Quote: ... were obtained from Lonza and were cultured in EGM-2 SingleQuot Kit media (Lonza, cat #CC-3162) and used at passage 2-10 ...
-
bioRxiv - Microbiology 2021Quote: ... cells were overlaid with 1:1 mixture of 2% agarose (Lonza, Basel, Switzerland) and 2X MEM medium ...
-
bioRxiv - Bioengineering 2022Quote: ... that was supplemented with EGM™-2 SingleQuots™ supplements (LONZA, CC-4176), 10 % FCS and 1 % P/S ...
-
bioRxiv - Molecular Biology 2022Quote: ... HAECs were cultured in EBM-2 supplemented with singleQuots (LONZA, Clonetics CC-4176) and Endothelial Cell Growth Kit-VEGF (ATCC ...
-
bioRxiv - Microbiology 2022Quote: Human corneal epithelial cells (hTCEpi) (67) were cultured in KGM-2 (Lonza, USA) supplemented with 1.15 mM calcium chloride (high-calcium ...
-
bioRxiv - Molecular Biology 2022Quote: ... and the recommended growth supplements (FGM™-2 SingleQuots™, CC-4126, Lonza). Primary human skin fibroblasts (2320 ...
-
bioRxiv - Molecular Biology 2022Quote: ... separated on a 2% or 4% agarose gel (Seakem LE agarose, Lonza #50004) by electrophoresis (120 V ...
-
bioRxiv - Bioengineering 2022Quote: ... LECs were cultured in EGM™-2 endothelial growth medium (Lonza, Basel, Switzerland). Primary HSCs were collected after selecting Kupffer cells and LECs ...
-
bioRxiv - Molecular Biology 2024Quote: ... 2-4 x 105 cells were resuspended in 100uL of P2 medium (Lonza) containing 10 µg of Cas9 or Cas9/guide plasmidic DNA and transferred to a cuvette (Lonza) ...
-
bioRxiv - Cancer Biology 2023Quote: 2.5 x 105 HUVEC (< 6th passage) in 120 µL EGM-2 media (Lonza) were seeded in channel slides (µ-Slides 0.4 Luer ...
-
bioRxiv - Cell Biology 2023Quote: ... Cells were cultured in Endothelial Cell Growth Medium-2 BulletKit (CC-3162, Lonza) with 100 U/ml Penicillin (Thermo Fisher Scientific ...
-
bioRxiv - Physiology 2023Quote: ... Preadipocyte cells were maintained in preadipocyte growth media-2 (Lonza Cat #PT-8002). For experiments ...
-
bioRxiv - Physiology 2023Quote: ... Preadipocyte cells were maintained in preadipocyte growth media-2 (Lonza Cat #PT-8002).
-
bioRxiv - Bioengineering 2023Quote: ... cultured according to supplier’s directions in supplemented EBM-2 endothelial basal medium (Lonza); and normal human astrocytes (NHAs ...
-
bioRxiv - Biophysics 2023Quote: ... 95% humidity and 5% CO2 in Fibroblast Growth Medium (FGM-2, Lonza, Basel).
-
bioRxiv - Bioengineering 2022Quote: ... Pre-adipocyte spheroids were maintained in pre-adipocyte growth medium (PGM-2, Lonza) containing 10% fetal bovine serum (FBS) ...
-
bioRxiv - Cell Biology 2023Quote: ... HEK STIM1/2-/- were transfected via electroporation using the Amaxa Nucleofector II (Lonza) according to the manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2023Quote: ... on 0.2% gelatin-coated plates with EGM-2 bulletkit medium (Lonza, Basel, Switzerland), containing EBM-2 basal medium along with the EGM-2 singlequots kit components ...
-
bioRxiv - Physiology 2023Quote: ... Switzerland) and supplemented with Microvascular Endothelial Cell Growth Medium-2 Bullet Kit (Lonza).
-
bioRxiv - Neuroscience 2023Quote: ... The squares were incubated for 2 minutes with L7 hPSC passaging solution (Lonza). After aspirating the L7 solution ...
-
bioRxiv - Bioengineering 2023Quote: ... were cultured at 37°C and 5% CO2 with EBM-2 medium (Lonza) and EGM-2MV supplements in T-75 flasks until confluent ...
-
bioRxiv - Cell Biology 2023Quote: ... 2 x 105 cells were resuspended in 20 µL Nuclofector Solution SF (Lonza), combined with the assembled Cas9 RNPs ...
-
bioRxiv - Developmental Biology 2024Quote: ... supplemented with EBM-2 SingleQuot supplement and growth factor kit (Lonza CC-4176). DNA binding assays were performed using the CUT&RUN Kit from Cell Signaling Technologies (CST 86652 ...
-
bioRxiv - Developmental Biology 2024Quote: ... TeloHAECs (ATCC, CRL-4052) were cultured in EBM-2 media (Lonza, CC-3156) supplemented with EGM-2 bullet kit (Lonza ...
-
bioRxiv - Bioengineering 2024Quote: ... supplemented with the EGMTM-2 Endothelial SingleQuotsTM Kit (Lonza Bioscience, Cat. # CC-4176) except for the provided FBS supplement ...
-
bioRxiv - Cell Biology 2024Quote: ... and the same supplements plus 2 mM UltraGlutamine I (Lonza, BE17-605E/U1).
-
bioRxiv - Molecular Biology 2024Quote: ... HPAECs were cultured for 4 hours in endothelial basal medium (EBM-2, Lonza) with 2% FBS ...