Labshake search
Citations for Lonza :
7001 - 7050 of 9615 citations since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2021Quote: ... EGM-2 medium (Lonza) supplemented with 16% defined foetal bovine serum (FBS ...
-
bioRxiv - Microbiology 2020Quote: ... Correct constructs were electroporated into Shigella using Amaxa 96-well shuttle system (Lonza).
-
bioRxiv - Microbiology 2020Quote: ... CRISPR-Cas9 RNP nucleofection was performed with the EH100 nucleofection protocol on a 4D Nucleofector device (Lonza) (Oh et al. ...
-
bioRxiv - Microbiology 2020Quote: ... Infected CD4 T cells were washed with PBS and 3 million cells per condition were resuspended in 20uL buffer P2 (Lonza) with 4μM IDT electroporation enhancer ...
-
bioRxiv - Microbiology 2020Quote: ... The hCMVmie is an optimized CMV promoter with synthetic intron and is derived from pEE12.4 vector (Lonza). The iRFP670 is a near-infrared fluorescent protein with the excitation/emission maxima at 643 nm/670 nm 38 ...
-
bioRxiv - Microbiology 2020Quote: ... resuspended in 25 μl Amaxa Basic Parasite Nucleofector solution (Lonza) and added to 10-20 μg DNA dissolved in 10 μl H2O ...
-
bioRxiv - Bioengineering 2020Quote: ... HUVECs (Lonza) were cultured in endothelial growth medium (EGM ...
-
Tuning trophoblast invasion in a gelatin hydrogel via soluble cues from the maternal-fetal interfacebioRxiv - Bioengineering 2020Quote: ... Routine mycoplasma testing was performed every 6 months to ensure cell quality using the MycoAlert™ Mycoplasma Detection Kit (Lonza).
-
Tuning trophoblast invasion in a gelatin hydrogel via soluble cues from the maternal-fetal interfacebioRxiv - Bioengineering 2020Quote: ... Lyophilized GelMA (23) was dissolved in phosphate buffered saline (PBS; Lonza, 17-516F) at 37°C to make 5 wt% polymer solutions ...
-
bioRxiv - Biophysics 2020Quote: Primary human mammary epithelial cells (HMECs; Lonza, Basel, Switzerland) were cultured in T-75 flasks in mammary epithelial basal medium (MEGM basal medium CC-3151 ...
-
bioRxiv - Biophysics 2020Quote: ... were cultured in T-75 flasks in mammary epithelial basal medium (MEGM basal medium CC-3151; Lonza) that was supplemented with bovine pituitary extract ...
-
bioRxiv - Biophysics 2020Quote: ... hydrocortisone and recombinant human epidermal growth factor (MEGM Bullet Kit CC-4136; Lonza). Cells were maintained in an incubator under standard conditions (36.5 °C ...
-
bioRxiv - Biophysics 2020Quote: ... The dissected femurs were placed in phosphate buffered saline (PBS) (Lonza, US) at 4°C and split prior to measurement ...
-
bioRxiv - Biophysics 2020Quote: ... and electroporated by means of a Nucleofector 2b device (Lonza) with pulse program B28 for HeLa cells ...
-
bioRxiv - Biophysics 2020Quote: ... Both cell lines were routinely cultured in high-glucose DMEM (Lonza) supplemented with 10% fetal bovine serum ...
-
bioRxiv - Cell Biology 2020Quote: ... supplemented with endothelial growth medium (EGM)-2 SingleQuots (LONZA Clonetics CC-4176) containing human epidermal growth factor (hEGF ...
-
bioRxiv - Microbiology 2020Quote: ... Human embryonic lung fibroblasts MRC-5 and human melanoma MeWo cells were cultured in DMEM (Lonza), supplemented with 10% FBS ...
-
bioRxiv - Microbiology 2020Quote: ... medium supplemented with 10% heat-inactivated fetal bovine serum (FBS; Lonza) and 0.6 mg/mL L-sodium glutamate (Lonza ...
-
bioRxiv - Microbiology 2020Quote: ... Human neuroblastoma SH-SY5Y cells were grown in a 1:1 (v/v) mixture of EMEM with EBSS (Lonza) and Ham’s F12 (Gibco ...
-
bioRxiv - Microbiology 2020Quote: ... medium supplemented with 15% FBS (Lonza), L-sodium glutamate ...
-
bioRxiv - Microbiology 2020Quote: ... and 0.6 mg/mL L-sodium glutamate (Lonza) or in DMEM/F-12+GlutaMAX-I (Thermo Fisher Scientific ...
-
bioRxiv - Microbiology 2020Quote: ... and natrium-bicarbonate (Lonza). Human embryonic lung fibroblasts MRC-5 and human melanoma MeWo cells were cultured in DMEM (Lonza) ...
-
bioRxiv - Microbiology 2020Quote: ... and routinely tested for mycoplasma contamination with the MycoAlert Mycoplasma Detection kit (Lonza). Two days before infection ...
-
bioRxiv - Microbiology 2020Quote: Human retinal pigmented epithelium ARPE-19 cells [American Type Culture Collection (ATCC) CRL-2302] were grown in a 1:1 (v/v) mixture of DMEM (Lonza) and Ham’s F12 (Gibco ...
-
bioRxiv - Molecular Biology 2020Quote: ... Primary human bronchial epithelial cells were also obtained from Lonza and grown in the recommended growth medium ...
-
bioRxiv - Molecular Biology 2020Quote: Primary human small airway epithelial cells were obtained from Lonza (Walkersville, MD) and PromoCell (Heidelberg ...
-
bioRxiv - Molecular Biology 2020Quote: ... and 24 h later transfected with 4 μg of pMaxGFP plasmid (Lonza) using Fugene HD transfection reagent (Promega ...
-
bioRxiv - Cell Biology 2020Quote: ... Cells were grown in Insect-XPRESS™ Protein-free Insect Cell Medium (Lonza; 12-730Q) supplemented with antibiotic-antimycotic (Thermo Fisher ...
-
bioRxiv - Neuroscience 2020Quote: ... 6 µg of total plasmid DNA (2 µg for each of the three episomal vectors) were electroporated into 5×10^5 fibroblasts with the Amaxaμ Human Dermal Fibroblast Nucleofectorμ Kit (Lonza, Basel, Switzerland; VDP-1001). The fibroblasts were further cultured for 6 days to allow them to recover ...
-
bioRxiv - Cell Biology 2020Quote: ... Both T cells and CD34+ HSCs were cultured in X-Vivo 15 media (Lonza) supplemented with 10% human serum AB (Merck Sigma-Aldrich) ...
-
bioRxiv - Cell Biology 2020Quote: ... Oil Red O staining was performed as described by the manufacturer (Lonza AG, Basel, Switzerland) and was followed by haematoxylin and eosin (H&E ...
-
bioRxiv - Cell Biology 2020Quote: ... an OsteoImage Assay (Lonza, Basel, Switzerland) was carried out ...
-
bioRxiv - Cell Biology 2020Quote: ... FADS 1 cells were grown in Minimum Essential Medium (MEM) Alpha (Lonza, Basel, Switzerland) supplemented with 15% foetal bovine serum (FBS ...
-
bioRxiv - Cell Biology 2020Quote: ... and 100 U/mL penicillin/streptomycin (Lonza). For Mo RNAseq and SILAC sample preparation ...
-
bioRxiv - Cell Biology 2020Quote: ... washed in PBS and resuspended in Roswell Park Memorial Institute (RPMI) medium: SILAC RPMI 1640 (Lonza) supplemented with 10% dialyzed FBS (Life Technologies) ...
-
bioRxiv - Cell Biology 2020Quote: ... 2 mM glutamine (Lonza) and 100 U/mL penicillin/streptomycin (Lonza) ...
-
bioRxiv - Cell Biology 2020Quote: ... 2 mM glutamine (Lonza) and 100 U/mL penicillin and streptomycin (Lonza) ...
-
bioRxiv - Cell Biology 2020Quote: Bone marrow cells were extracted from long bones of C57BL/6J mice 6 to 8 weeks of age as described (Guimbal et al.. 2019) and cultured in α-minimal essential medium (αMEM. Lonza) containing 10% Fetal Bovine Serum (FBS ...
-
bioRxiv - Cell Biology 2020Quote: ... and 100 U/mL penicillin and streptomycin (Lonza). 3 × 107 cells per 150 mm dishes at 37°C ...
-
bioRxiv - Cell Biology 2020Quote: ... Cryopreservation was performed using Profreeze freezing medium (Lonza) according to the manufacturer’s instructions and using epithelial cell culture medium as defined above to dilute the stock solution.
-
bioRxiv - Cell Biology 2020Quote: ... Cells were grown in DMEM with L-glutamine (Lonza, UK cat: R8758) supplemented with 10% FCS (SIGMA ...
-
bioRxiv - Cell Biology 2020Quote: ... and 7 mM Na2HPO4 in nuclease-free water) using either the Amaxa nucleofector system II (Lonza) under nucleofection program T-005 or the Amaxa 4Dnucleofector system (Lonza ...
-
bioRxiv - Cell Biology 2020Quote: ... Cell cultures were trypsinized and transient transfections for actin-mRFP were performed according to manufacturer’s protocol by using the Nucleofector apparatus (Lonza, formerly Amaxa Biosystems ...
-
bioRxiv - Cell Biology 2020Quote: ... Fluorescent nuclear counterstaining was performed using DAPI (Lonza, cat#: PA3013).
-
bioRxiv - Cell Biology 2020Quote: ... RNP complex was added to ssDNA GATA4 V267M repair template (IDT) and delivered to wildtype iPSCs by electroporation with the Amaxa human stem cell nucleofector starter kit (Lonza). Following electroporation ...
-
bioRxiv - Cell Biology 2020Quote: ... The PCR products were resolved on a MetaPhor gel (Lonza, Basel, Switzerland) and sequenced ...
-
bioRxiv - Cell Biology 2020Quote: ... supplemented with 20% fetal calf serum (FCS; Lonza Group, Ltd.). Primary human mammary epithelial cells (HuMECs ...
-
bioRxiv - Cell Biology 2020Quote: ... or a FOXO1-targeted siRNA (GAGCGUGCCCUACUUCAAGGA) using the Amaxa(tm) Basic Nucleofector(tm) Kit for Primary Mammalian Fibroblasts (Lonza), according to the manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2020Quote: ... which were maintained using FGM-2 culture medium and protocols provided by the manufacturer (Lonza Inc.). For visualization purposes ...
-
bioRxiv - Cell Biology 2020Quote: ... the OsteoLyse assay (Lonza, Basel, Switzerland) was employed ...