Labshake search
Citations for Lonza :
601 - 650 of 1686 citations for hsa mir 483 5p Real time RT PCR Detection Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Developmental Biology 2020Quote: ... The PCR cycle number was evaluated using a FlashGelTM System (Lonza, 57063). The volume of the PCR product was adjusted to 100 μL by adding 50 µl TE buffer ...
-
bioRxiv - Neuroscience 2020Quote: ... PCR products were resolved on 2% high-resolution Metaphor agarose gels (Lonza).
-
bioRxiv - Microbiology 2022Quote: ... PCR products were loaded on 1.5% agarose gel (Lonza SeaKem LE Agarose) at constant voltage of 70V for one hour ...
-
bioRxiv - Molecular Biology 2023Quote: ... PCR samples were visualized on 1.5% SeaKem LE agarose (Lonza; Rockland, ME) gels containing 0.5x GelRed (Biotium ...
-
bioRxiv - Plant Biology 2023Quote: ... PCR products were visualized on a FlashGel™ system (Lonza, Basel, Switzerland), cleaned up using ExoSAP-IT Express (Applied Biosystems ...
-
bioRxiv - Neuroscience 2021Quote: ... Tissues were washed 3-4 times over 1 hour in PBS (calcium- and magnesium-free; Lonza BioWhittaker #17-517Q) containing 0.1% Triton X-100 (PBT ...
-
bioRxiv - Cancer Biology 2022Quote: ... Cells were maintained in culture for the indicated time in the following medium: X-VIVO 10 (Lonza, BE04-380Q) supplemented with 20% BIT 9500 Serum Substitute (StemCell technologies ...
-
bioRxiv - Immunology 2020Quote: ... Colons were incubated 2 times at 200 rpm in 40 mL HBSS + 0.1% BSA + 1% Penicillin-Streptomycin (PS, Lonza) + 5mM EDTA (Sigma-Aldrich ...
-
bioRxiv - Microbiology 2019Quote: ... the monolayers were washed three times with ice-cold PBS and overlaid with 2 ml of Joklik’s minimal essential medium (Lonza) supplemented with 5% fetal bovine serum (Life Technologies) ...
-
bioRxiv - Microbiology 2019Quote: ... the monolayers were washed three times with ice-cold PBS and overlaid with 2 ml of Joklik’s minimal essential medium (Lonza) supplemented with 5% fetal bovine serum (Life Technologies) ...
-
bioRxiv - Microbiology 2019Quote: ... the monolayers were washed three times with ice-cold PBS and overlaid with 2 ml of Joklik’s minimal essential medium (Lonza) supplemented with 5% fetal bovine serum (Life Technologies) ...
-
bioRxiv - Microbiology 2019Quote: ... the monolayers were washed three times with ice-cold PBS and overlaid with 2 ml of Joklik’s minimal essential medium (Lonza) supplemented with 5% fetal bovine serum (Life Technologies) ...
-
bioRxiv - Immunology 2019Quote: ... Colons were incubated 2 times at 200 rpm in 40 mL HBSS + 0.1% BSA + 1% Penicillin-Streptomycin (PS, Lonza) + 5mM EDTA (Sigma-Aldrich ...
-
bioRxiv - Cell Biology 2023Quote: ... PCR products were separated by 3% low melting agarose gel (Lonza, cat#50111) and detected with Gel Image System (Tanon 1600) ...
-
bioRxiv - Bioengineering 2023Quote: ... washed three times in PBS and cultured on collagen-coated 6-well plates in endothelial growth medium (EGM-2, Lonza) composed of endothelial basal medium supplemented with 2% fetal bovine serum ...
-
bioRxiv - Immunology 2023Quote: ... Blood samples were collected by either cardiac punction at termination or via tail vein at the indicated time points and were processed using ACK (Lonza) to deplete red blood cells ...
-
bioRxiv - Plant Biology 2024Quote: ... The fixed cells were washed three times with the same buffer and then embedded in 2 % low-melting-temperature agarose (SeaPlaque, Lonza). The embedded samples were post-fixed with 4 % potassium permanganate at 4 °C for 2 h ...
-
bioRxiv - Molecular Biology 2020Quote: ... PCR tubes were placed above a gel-viewing blue LED powered light box (Lonza Flashgel Dock or IO Rodeo Midi Blue LED Transilluminator ...
-
bioRxiv - Molecular Biology 2021Quote: ... PCR reactions were run on a 2% agarose gel (NuSieve™ GTG™, Lonza) and the 200-400 bp region was excised and purified using a QIAquick Gel Extraction Kit (#28704 ...
-
bioRxiv - Molecular Biology 2023Quote: ... All PCR products and double-stranded DNAs were purified with agarose gels (Lonza, 50004) and the GeneJet Gel Extraction Kit (Thermo Fisher ...
-
bioRxiv - Cell Biology 2020Quote: ... The medium was removed and each dish was washed three times with cold DPBS buffer without CaCl2 (Lonza Bioscience, Bâle, Switzerland). Then ...
-
bioRxiv - Genomics 2019Quote: ... DNA fragments underwent PCR-based amplification using Illumina’s Nextera® primers and the resulting libraries were subjected to electrophoresis for the indicated time in 1% agarose gels (Lonza) at 3.0 V cm-1 in TBE buffer (50 mM Tris-borate ...
-
bioRxiv - Molecular Biology 2019Quote: ... buffer kit V (Lonza) and program A-023 ...
-
bioRxiv - Cancer Biology 2023Quote: ... (kit C, W001; Lonza) and CD81 positive cells sorted (ARIA III BD ...
-
bioRxiv - Microbiology 2022Quote: ... supernatants were diluted 20-50 times before a Limulus amoebocyte (LAL) kinetic-QCL assay was applied according to the manufacturer’s instructions (Lonza Ltd., Basel, CH). The detection limit of the assay was estimated at 0.5 -2.5 EU/filter depending on the dilution rate ...
-
bioRxiv - Microbiology 2021Quote: ... All amplified PCR products were electrophoretically analyzed in 3% agarose gel (MetaPhor Agarose, Lonza Group) stained with 0.5 μg/mL ethidium bromide ...
-
bioRxiv - Immunology 2019Quote: The Nucleofector transfection kit (Lonza) was used to transfect siRNA into cells ...
-
bioRxiv - Microbiology 2023Quote: A ToxiLight BioAssay Kit (Lonza) was used to determine cell death ...
-
bioRxiv - Microbiology 2023Quote: ... and Nucleofector Kit R (Lonza) following manufacturer instructions ...
-
bioRxiv - Molecular Biology 2024Quote: ... using ToxiLight bioassay kit (Lonza) according to the manufacture’s recommendations.
-
bioRxiv - Immunology 2019Quote: ... pFLAG-GFP was constructed by PCR-amplifying GFP coding sequence from pMAX-GFP (Lonza, Alpharetta, GA) with GGGAATTCAAGTAAAGGAGAAGAACTTTTC and GGGATCCCTATTTGTATAGTTCATCCATGCC primers ...
-
bioRxiv - Biophysics 2019Quote: ... These growth factors were supplied as a bullet kit (Cell Media and Bullet Kit, Lonza). HUVECs were passaged 2-6 times.
-
bioRxiv - Bioengineering 2019Quote: ... and EGM-2 bullet kit (Lonza)) and maintained at ALI for three weeks.
-
bioRxiv - Developmental Biology 2019Quote: ... using a HUVEC Nucleofector kit (Lonza) according to manufacturer’s instructions and the cells were further cultured for 72 hours ...
-
bioRxiv - Cancer Biology 2019Quote: ... using the MycoAlert Kit (Lonza, Switzerland). NIH3T3 mouse embryonic fibroblasts were stably transfected with pCMV_HER4 that encodes the JMa/CYT1 isoform ...
-
bioRxiv - Immunology 2021Quote: ... and Nucleofector kits (Lonza, VPB-1002) following the manufacturer’s instruction ...
-
bioRxiv - Cancer Biology 2022Quote: ... Regular testing with MycoAlert kit (Lonza) confirmed the absence of mycoplasma contamination ...
-
bioRxiv - Cancer Biology 2020Quote: ... using MycoAlert™ kit (Lonza, Germany) and genetically authenticated using a STR-PCR fragments kit (Agilent Technologies ...
-
bioRxiv - Immunology 2019Quote: ... Kit T solution (Lonza, Basel, Switzerland), and programs G-016 ...
-
bioRxiv - Cell Biology 2019Quote: ... and MF 1 Nucleofector kit (Lonza) according to the manufactures protocols ...
-
bioRxiv - Immunology 2021Quote: ... Nucleofector Kit V was from Lonza. The original vector pCasper-GR (#FP971 ...
-
bioRxiv - Cancer Biology 2021Quote: ... supplemented with the SingleQuots kit (Lonza), 5 μg/ml transferrin (Sigma-Aldrich ...
-
bioRxiv - Biochemistry 2022Quote: ... Nucleofector Kit V (Lonza, VCA-1003); paraformaldehyde (Electron Microscopy Sciences ...
-
bioRxiv - Neuroscience 2023Quote: ... with the full growth kit (Lonza) and passaged using TrypLE Express.
-
bioRxiv - Cancer Biology 2023Quote: Cell□line□specific Nucleofector Kits (Lonza) were used for transfections which were performed according to manufacturer’s protocol on a Nucleofector® 2b Device (Lonza) ...
-
bioRxiv - Microbiology 2024Quote: Toxilight Bioassay Kit (Lonza, LT17-127) or LDH-Glo Cytotoxicity Assay (Promega ...
-
bioRxiv - Bioengineering 2024Quote: ... Electroporation kit V and Electroporation kits for Primary T-Cell/HSPC were purchased from Lonza (Basel, Switzerland) and used on the Lonza Nucleofector 2b system ...
-
bioRxiv - Plant Biology 2023Quote: ... and PCR products were separated by agarose gel electrophoresis in an 1% w/v agarose gel (Lonza, 50004) using 100V during 30 min ...
-
bioRxiv - Microbiology 2024Quote: ... The PCR product presence was confirmed with gel electrophoresis using the FlashGel® System (Lonza, Rockland, ME, USA). PCR products were then purified with the HighPrep® PCR kit (MagBio Genomics ...
-
bioRxiv - Synthetic Biology 2019Quote: ... using the SF Cell Line 4D-Nucleofector® × Kit L or × Kit S (Lonza, V4XC-2024, V4XC-2032) with the program CQ-104 ...