Labshake search
Citations for Lonza :
601 - 650 of 1157 citations for 2 CHLOROMETHYL 6 METHOXY 1H BENZO D IMIDAZOLE since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Physiology 2022Quote: ... 5 million cells were washed with phosphate buffered saline (PBS) and electroporated with 4-6 μg of appropriate plasmid construct using an Amaxa cell nucleofector (Lonza laboratories) and nucleofection reagent (362.88 mM ATP-disodium salt ...
-
bioRxiv - Physiology 2024Quote: The gRNA plasmid (1µg) and donor template plasmid (3µg) were introduced into 3T3-L1 cells (1X 10 6 cell) by electroporation (LONZA, Basel, Switzerland). After 48h of electroporation ...
-
bioRxiv - Cell Biology 2020Quote: ... cell monolayers were washed twice in sterile D-PBS and cells were detached with Trypsin 0.5 g/L EDTA 0.2 g/L (Lonza, # BE17-161E) for 5 minutes ...
-
bioRxiv - Microbiology 2020Quote: ... 20 µL of cell suspension was then gently mixed with each crRNP and aliquoted into a 96-well electroporation cuvette for nucleofection with the 4-D Nucleofector X-Unit (Lonza) using pulse code EO-120 ...
-
bioRxiv - Microbiology 2021Quote: ... Tightly synchronized schizonts were transfected using the Amaxa 4-D electroporator and P3 Primary Cell 4D Nucleofector X Kit L (Lonza) according to the protocol described by Moon et al ...
-
bioRxiv - Cell Biology 2022Quote: ... and 20 μg of the donor DNA using the Amaxa 4-D Nucleofactor X machine (Pulse code FP158) and P3 Primary Cell Kit (Lonza), according to protocols described by Moon et al ...
-
bioRxiv - Molecular Biology 2022Quote: ... D-PBS was gently aspirated from the T cell pellet and then resuspended in 15 μL of buffer P3 (Lonza). The cell suspension was then transferred to the RNP mix and thoroughly triturated ...
-
bioRxiv - Neuroscience 2024Quote: ... along with 20 μg recombinant Cas9 (IDT) and 1 pmol of each bridging oligonucleotide using the P3 Primary Cell 4-D-Nucleofector kit (Lonza) using the CA-137 program34 ...
-
bioRxiv - Neuroscience 2024Quote: ... 500 pmol Cas12 crRNA (GGAAAAGTAAAAGATGTCTGAAT, IDT) and 20 μg recombinant Cas12 (IDT) using the P3 Primary Cell 4-D-Nucleofector kit (Lonza) and 4D-Nucleofector X unit (Lonza ...
-
bioRxiv - Systems Biology 2024Quote: ... 20 µL of cell suspension was then gently mixed with each crRNP and aliquoted into a 96-well electroporation cuvette for nucleofection with the 4-D Nucleofector X-Unit (Lonza) using pulse code EO-120 ...
-
bioRxiv - Immunology 2024Quote: ... A volume of 20 μL of cells was then transferred to the Nucleocuvette stripwell and electroporated with program DN-100 on a 4-D Nucleofector X unit (Lonza). Immediately after nucleofection ...
-
Synchronous 3D patterning of diverse CNS progenitors generates motor neurons of broad axial identitybioRxiv - Neuroscience 2024Quote: ... For the generation the ISL1 reporter line cells were nucleofected with pTG-Cr-ISL1 and pTG-HR-ISL1-p2A-mNeonGreen plasmids using a 4-D nucleofector system (AMAXA) and the P3 Primary Cell 4D-Nucleofector Kit (Lonza) following manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2021Quote: ... CD31+ BECs were resuspended in fresh EBM-2 basal medium with all supplements (#CC-3202, EGM™-2-MV BulletKit™, Lonza, Portsmouth, NH, USA). Then ...
-
bioRxiv - Developmental Biology 2021Quote: Human isogenic ESCs containing different lengths of CAG repeats in the HTT Exon1 locus (HD-RUES2 6) were nucleofected using the Cell Line Nucelofector II (Kit L from Lonza, Walkersville, MD) by applying the B-016 program ...
-
bioRxiv - Cell Biology 2020Quote: ... 1×106 cells (grown in 6-well dishes) were subjected to nucleofection with Amaxa® Cell Line Nucleofector® kit V (VCA-1003, Lonza), following the manufacturer’s protocol ...
-
bioRxiv - Cancer Biology 2021Quote: ... Collected cells were counted at a density of 100,000 per well and seeded on matrigel pre-coated 6-well plates supplied with KBM-Gold keratinocyte growth medium (Lonza, Cat# 00192060) at 37°C in a humidified chamber with 5% carbon dioxide ...
-
bioRxiv - Cancer Biology 2021Quote: ... Primary uveal melanoma cells were equally divided onto two wells of a fibronectin-covered 6-well tissue culture plate and grown in 5% CO2 in MDMF medium which consists of HAM’s F12 (Lonza, Walkersville MD, USA) supplemented with 1 mg/mL BSA (Sigma-Aldrich ...
-
bioRxiv - Cell Biology 2023Quote: ... RPE1 cell pellets containing 1×10^6 cells were resuspended in Nucleofection Solution for Primary Mammalian Epithelial Cells (Lonza cat# VPI-1005) in the presence of nucleofection enhancer (cat# 1075915 ...
-
bioRxiv - Neuroscience 2023Quote: ... Nucleofection was performed using the 4-D nucleofector system (AMAXA) and the P3 Primary Cell 4D-Nucleofector Kit (Lonza, V4XP-3024) following manufactures’ instructions (program CB-150) ...
-
bioRxiv - Biochemistry 2024Quote: ... and 50 mM D-mannitol] modified from a previous report,86 and electroporation was performed by a Nucleofector 2b device (Lonza Bioscience). Cells were transfected with siRNAs twice with a 48-h interval ...
-
bioRxiv - Bioengineering 2022Quote: ... were seeded at a density of 200,000 cells/cm2 onto collagen (Corning)-coated plates and cultured in endothelial growth media-2 (EGM2, Lonza) at 37°C and 5% CO2 overnight ...
-
bioRxiv - Cell Biology 2020Quote: ... was cultured on gelatin-coated culture plates in EGM-2 (Lonza). All medium were supplemented with 10% FBS and antibiotics/antimicotic (Sigma) ...
-
bioRxiv - Bioengineering 2020Quote: ... HUVEC cells were cultured to <8 passages in EBM-2 (Lonza) supplemented with EGM-2 Single Quots (Lonza) ...
-
bioRxiv - Cell Biology 2021Quote: ... were maintained in Skeletal Muscle Growth Media-2 (CC-3245; Lonza) on the dishes coated with collagen type I-C (Cellmatrix ...
-
bioRxiv - Cell Biology 2021Quote: ... were purchased from Lonza and maintained in endothelial growth medium (EGM-2, Lonza, CC-3162), with 5% CO2 ...
-
bioRxiv - Cell Biology 2020Quote: ... Cells were replated in SKGM medium (SKGM-2, Lonza CC-3245) supplemented with Rock inhibitor (#1254 ...
-
bioRxiv - Cell Biology 2020Quote: ... NJ) and were cultured in in EGM-2 (Lonza, CC-3162). Adult human dermal fibroblasts (HDFs ...
-
bioRxiv - Cell Biology 2021Quote: ... were maintained in culture using Endothelial Basal Medium (EBM-2, Lonza) supplemented with hydrocortisone ...
-
bioRxiv - Cell Biology 2022Quote: ... MLECs were cultured in EGM-2 MV media (Lonza, Walkersville, MD).
-
bioRxiv - Pathology 2022Quote: ... cells were starved in EBM- 2 basal medium (Lonza, #CC-3162) with 0.5% fetal bovine serum for 12 h ...
-
bioRxiv - Immunology 2020Quote: ... supplemented with 10% FCS and 2 mM glutamine (Lonza, BE17-605F). For lentivirus production ...
-
bioRxiv - Microbiology 2021Quote: ... # C2519A) and cultured in EGM-2 complete medium (Lonza, # CC-3162) without antibiotics ...
-
bioRxiv - Biochemistry 2020Quote: ... the cells were washed 2 times with HBSS (Lonza, #BE10-527F) and imaged in DMEM with 10% FBS ...
-
bioRxiv - Bioengineering 2020Quote: ... Cells were cultured in a supplemented (EGM-2 bullet kit, LONZA) endothelial cell growth medium (Lifeline cell technology ...
-
bioRxiv - Molecular Biology 2022Quote: ... PCR samples were analyzed on 2% agarose gels (Lonza Rockland, ME), 1X TAE ...
-
bioRxiv - Bioengineering 2022Quote: EGM is composed of Endothelial Cell Basal Medium-2 (EBM) (Lonza) supplemented with MV Microvascular Endothelial Cell Growth Medium-2 BulletKit™ (Lonza) ...
-
bioRxiv - Immunology 2021Quote: ... 2×106 UVC cells were electroporated using a Neon Nucleofector (Lonza) in Buffer P3 (Lonza ...
-
bioRxiv - Cancer Biology 2021Quote: ... Following transfection with the Amaxa Stem Cell Nucleofector Kit 2 (Lonza) using an Amaxa Nucleofector II machine ...
-
bioRxiv - Cancer Biology 2021Quote: ... HSMMs and CnSkMCs were cultured in SkGM-2 (CC-3245, Lonza) and CnSkMC growth medium (Cn151-500 ...
-
bioRxiv - Cell Biology 2021Quote: ... using 2 × 106 tachyzoites in 20 μL of buffer P3 (Lonza) with the F1-115 pulse code ...
-
bioRxiv - Cell Biology 2021Quote: ... NJ) and were cultured in in EGM-2 (Lonza, CC-3162) and used between passages 2 - 6 ...
-
bioRxiv - Cell Biology 2022Quote: ... the PBS was removed and 3 mL of SkBM-2 (Lonza) media was added to each chamber ...
-
bioRxiv - Cell Biology 2022Quote: ... were grown in endothelial growth medium (EGM-2, Lonza, CC-3162) until 90% confluent ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... 10% FBS and Gentamicin/Amphotericin B (FGM-2, singlequots, Clonetics/Lonza); cells were divided before reaching 80% confluency ...
-
bioRxiv - Microbiology 2022Quote: ... The channels were filled with 2% agarose (Lonza, cat. no. 50302) and the whole chip was embedded in O.C.T ...
-
bioRxiv - Genomics 2022Quote: ... cells were grown and passaged in complete Endopan-2 medium (Lonza) until 90% confluency and scraped in PB ...
-
bioRxiv - Molecular Biology 2024Quote: ... and cultured in the appropriate media (SKBM-2 Bullet kit, Lonza, Basel ...
-
bioRxiv - Cell Biology 2024Quote: ... The basal medium EBM-2 and supplements were obtained from Lonza. Cells between passages 1-5 were used for experiments ...
-
bioRxiv - Cell Biology 2024Quote: ... along with the Human Stem Cell Nucleofector™ Kit 2 (Lonza). Briefly ...
-
bioRxiv - Cell Biology 2023Quote: ... ECs were cultured in EGM-2 medium (Cat CC-3162, Lonza) supplemented with 8μM SB431542 ...